\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102386398:

Variant ID: vg0102386398 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2386398
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACAATTTGGCAAAAAGATCTATGAGCACTCATCTGTAAAAATAAATAATTCATTAGGGTGTAATTTGTAAATTGTCTTGAGTCTTTACGAACAAATCC[C/T]
TATCCTGCATACCGCCATCGTCTCTTTCTCGTCGTCGCCGGCGACGCCTCCCGCCGCCGCCGAGGATGCCAGTGAGGGTGGTCGACACCGCAACCCCATC

Reverse complement sequence

GATGGGGTTGCGGTGTCGACCACCCTCACTGGCATCCTCGGCGGCGGCGGGAGGCGTCGCCGGCGACGACGAGAAAGAGACGATGGCGGTATGCAGGATA[G/A]
GGATTTGTTCGTAAAGACTCAAGACAATTTACAAATTACACCCTAATGAATTATTTATTTTTACAGATGAGTGCTCATAGATCTTTTTGCCAAATTGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.10% 16.80% 0.11% 0.00% NA
All Indica  2759 87.30% 12.60% 0.07% 0.00% NA
All Japonica  1512 73.00% 26.90% 0.07% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 96.30% 3.70% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 75.60% 24.40% 0.00% 0.00% NA
Indica Intermediate  786 88.00% 11.70% 0.25% 0.00% NA
Temperate Japonica  767 96.90% 3.10% 0.00% 0.00% NA
Tropical Japonica  504 33.90% 65.90% 0.20% 0.00% NA
Japonica Intermediate  241 78.80% 21.20% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 73.30% 24.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102386398 C -> T LOC_Os01g05090.1 5_prime_UTR_variant ; 66.0bp to feature; MODIFIER silent_mutation Average:90.739; most accessible tissue: Zhenshan97 flag leaf, score: 93.632 N N N N
vg0102386398 C -> T LOC_Os01g05070.1 upstream_gene_variant ; 3708.0bp to feature; MODIFIER silent_mutation Average:90.739; most accessible tissue: Zhenshan97 flag leaf, score: 93.632 N N N N
vg0102386398 C -> T LOC_Os01g05080.1 upstream_gene_variant ; 760.0bp to feature; MODIFIER silent_mutation Average:90.739; most accessible tissue: Zhenshan97 flag leaf, score: 93.632 N N N N
vg0102386398 C -> T LOC_Os01g05070.2 upstream_gene_variant ; 3708.0bp to feature; MODIFIER silent_mutation Average:90.739; most accessible tissue: Zhenshan97 flag leaf, score: 93.632 N N N N
vg0102386398 C -> T LOC_Os01g05080.2 upstream_gene_variant ; 760.0bp to feature; MODIFIER silent_mutation Average:90.739; most accessible tissue: Zhenshan97 flag leaf, score: 93.632 N N N N
vg0102386398 C -> T LOC_Os01g05100.1 downstream_gene_variant ; 1810.0bp to feature; MODIFIER silent_mutation Average:90.739; most accessible tissue: Zhenshan97 flag leaf, score: 93.632 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0102386398 C T -0.05 -0.09 -0.07 -0.06 -0.07 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102386398 8.89E-06 5.02E-08 Yield Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0102386398 NA 9.80E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102386398 NA 7.59E-11 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102386398 NA 2.17E-16 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102386398 NA 8.54E-06 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102386398 NA 2.72E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102386398 NA 1.42E-08 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102386398 NA 2.19E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102386398 NA 7.76E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102386398 NA 1.37E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102386398 NA 4.58E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102386398 NA 2.54E-11 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102386398 NA 8.53E-18 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102386398 NA 1.41E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102386398 NA 1.63E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251