\
| Variant ID: vg0102369472 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 2369472 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTCAAATCATCCAGTGAGCCAGGTATATGCATCAGAATCCTCCAATGAGCCAAGCATATGCATCTGATCTGCCCACAATTGTCATTATACTATATGATTA[G/A]
CATTCCTCCATGCAAGCCAAGTTGCCAACGGAGAATCAAGGATCTAACAAGTTCCATCAGATCAGGGCCGGCCCTGCTTGTGCCCTTTTATCTTCCTCTT
AAGAGGAAGATAAAAGGGCACAAGCAGGGCCGGCCCTGATCTGATGGAACTTGTTAGATCCTTGATTCTCCGTTGGCAACTTGGCTTGCATGGAGGAATG[C/T]
TAATCATATAGTATAATGACAATTGTGGGCAGATCAGATGCATATGCTTGGCTCATTGGAGGATTCTGATGCATATACCTGGCTCACTGGATGATTTGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 40.50% | 59.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0102369472 | G -> A | LOC_Os01g05030.1 | downstream_gene_variant ; 1554.0bp to feature; MODIFIER | silent_mutation | Average:36.933; most accessible tissue: Callus, score: 86.456 | N | N | N | N |
| vg0102369472 | G -> A | LOC_Os01g05040.1 | downstream_gene_variant ; 57.0bp to feature; MODIFIER | silent_mutation | Average:36.933; most accessible tissue: Callus, score: 86.456 | N | N | N | N |
| vg0102369472 | G -> A | LOC_Os01g05050.1 | downstream_gene_variant ; 2851.0bp to feature; MODIFIER | silent_mutation | Average:36.933; most accessible tissue: Callus, score: 86.456 | N | N | N | N |
| vg0102369472 | G -> A | LOC_Os01g05060.1 | downstream_gene_variant ; 5000.0bp to feature; MODIFIER | silent_mutation | Average:36.933; most accessible tissue: Callus, score: 86.456 | N | N | N | N |
| vg0102369472 | G -> A | LOC_Os01g05030-LOC_Os01g05040 | intergenic_region ; MODIFIER | silent_mutation | Average:36.933; most accessible tissue: Callus, score: 86.456 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0102369472 | 6.68E-06 | NA | mr1228_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102369472 | NA | 1.29E-06 | mr1597_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102369472 | NA | 5.80E-06 | mr1912_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |