\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102349632:

Variant ID: vg0102349632 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2349632
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTCTTATGAGTAATATATTCCCCCTTCCCGCAAAAAAAAGAAAAAAAAGAAAAAAGAAGGTTCATGCGGCCACAAGTTGAACAGAGGTGTTACTTGTAT[T/C]
GAAGCCTTGGCCGGGCTGCTCCAGGGAGAAGGAAGCCAACTTTTCAAAACAACATGTCATGTCGGGATTTCCTGTGGTTTCTAATTTAAAAAGGTAGCCC

Reverse complement sequence

GGGCTACCTTTTTAAATTAGAAACCACAGGAAATCCCGACATGACATGTTGTTTTGAAAAGTTGGCTTCCTTCTCCCTGGAGCAGCCCGGCCAAGGCTTC[A/G]
ATACAAGTAACACCTCTGTTCAACTTGTGGCCGCATGAACCTTCTTTTTTCTTTTTTTTCTTTTTTTTGCGGGAAGGGGGAATATATTACTCATAAGAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 6.40% 0.51% 0.00% NA
All Indica  2759 99.90% 0.10% 0.04% 0.00% NA
All Japonica  1512 79.60% 19.00% 1.46% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 67.90% 29.30% 2.74% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 75.90% 23.70% 0.41% 0.00% NA
VI/Aromatic  96 86.50% 12.50% 1.04% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102349632 T -> C LOC_Os01g04990.1 downstream_gene_variant ; 287.0bp to feature; MODIFIER silent_mutation Average:63.012; most accessible tissue: Zhenshan97 root, score: 84.911 N N N N
vg0102349632 T -> C LOC_Os01g04990.2 downstream_gene_variant ; 287.0bp to feature; MODIFIER silent_mutation Average:63.012; most accessible tissue: Zhenshan97 root, score: 84.911 N N N N
vg0102349632 T -> C LOC_Os01g04980-LOC_Os01g04990 intergenic_region ; MODIFIER silent_mutation Average:63.012; most accessible tissue: Zhenshan97 root, score: 84.911 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102349632 NA 4.40E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0102349632 NA 6.29E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0102349632 NA 1.85E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632 NA 4.63E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632 NA 2.96E-09 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632 NA 4.16E-07 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632 1.88E-06 7.92E-13 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632 NA 1.24E-07 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632 NA 9.91E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632 1.12E-06 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632 2.83E-08 4.51E-19 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632 NA 8.19E-08 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632 NA 4.72E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632 NA 8.72E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632 NA 7.84E-18 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632 2.56E-08 3.12E-23 mr1902_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102349632 NA 1.55E-08 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251