\
| Variant ID: vg0102330722 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 2330722 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GATTAGCTCTAATCTTTAGCAGATTCTGGCTCTGTCACTGGTTAAAAGTACAGAGGATCTTGCTAACACCATTGTTCCAGTAACTTTTGAGTATAACAGT[A/G]
AAGTCCCGCACTGATGCTCCTCATTCTTGTCTAGATTTGCCCAGTCGGCCCAAACTGAAATTTCCCGATGTCTCTCATGCTTAATTACATAATAGTTACA
TGTAACTATTATGTAATTAAGCATGAGAGACATCGGGAAATTTCAGTTTGGGCCGACTGGGCAAATCTAGACAAGAATGAGGAGCATCAGTGCGGGACTT[T/C]
ACTGTTATACTCAAAAGTTACTGGAACAATGGTGTTAGCAAGATCCTCTGTACTTTTAACCAGTGACAGAGCCAGAATCTGCTAAAGATTAGAGCTAATC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.60% | 1.00% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 96.80% | 2.10% | 1.12% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 95.80% | 2.30% | 1.83% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 5.40% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 15.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0102330722 | A -> G | LOC_Os01g04970.1 | downstream_gene_variant ; 1866.0bp to feature; MODIFIER | silent_mutation | Average:34.855; most accessible tissue: Callus, score: 83.454 | N | N | N | N |
| vg0102330722 | A -> G | LOC_Os01g04970-LOC_Os01g04980 | intergenic_region ; MODIFIER | silent_mutation | Average:34.855; most accessible tissue: Callus, score: 83.454 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0102330722 | 1.76E-06 | 1.76E-06 | mr1389 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102330722 | 1.37E-08 | 1.37E-08 | mr1024_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102330722 | 1.41E-11 | 1.45E-10 | mr1038_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102330722 | 3.24E-06 | 3.24E-06 | mr1191_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102330722 | 3.01E-07 | 3.01E-07 | mr1367_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102330722 | NA | 7.42E-08 | mr1565_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102330722 | NA | 7.27E-06 | mr1842_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |