\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102177582:

Variant ID: vg0102177582 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2177582
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCTCCCCAGCCCCAACACGACAAATAAAAGCCGGAGAGAGAGAGAGCAGGTATAATAGATAAACAGTTATAAATATATTTTAAAGAGATAAAAGAAAA[G/T]
AGAGAAAAGTAACGGGCTATAAATTTGTAGCCAGCTACAGCATGGCCTTCAAGATATAATGTATGTATGATAGATAGGACCATATATTAATAGTATAGTA

Reverse complement sequence

TACTATACTATTAATATATGGTCCTATCTATCATACATACATTATATCTTGAAGGCCATGCTGTAGCTGGCTACAAATTTATAGCCCGTTACTTTTCTCT[C/A]
TTTTCTTTTATCTCTTTAAAATATATTTATAACTGTTTATCTATTATACCTGCTCTCTCTCTCTCCGGCTTTTATTTGTCGTGTTGGGGCTGGGGAGCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.70% 0.90% 3.24% 46.15% NA
All Indica  2759 33.60% 1.40% 2.79% 62.27% NA
All Japonica  1512 84.40% 0.10% 4.03% 11.51% NA
Aus  269 11.90% 0.40% 4.83% 82.90% NA
Indica I  595 69.20% 0.80% 0.67% 29.24% NA
Indica II  465 6.70% 2.40% 2.15% 88.82% NA
Indica III  913 24.10% 0.30% 2.30% 73.27% NA
Indica Intermediate  786 33.50% 2.40% 5.34% 58.78% NA
Temperate Japonica  767 82.50% 0.10% 1.04% 16.30% NA
Tropical Japonica  504 89.10% 0.00% 8.33% 2.58% NA
Japonica Intermediate  241 80.50% 0.00% 4.56% 14.94% NA
VI/Aromatic  96 69.80% 0.00% 0.00% 30.21% NA
Intermediate  90 55.60% 1.10% 2.22% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102177582 G -> T LOC_Os01g04770.1 upstream_gene_variant ; 3764.0bp to feature; MODIFIER silent_mutation Average:95.755; most accessible tissue: Zhenshan97 young leaf, score: 99.61 N N N N
vg0102177582 G -> T LOC_Os01g04760-LOC_Os01g04770 intergenic_region ; MODIFIER silent_mutation Average:95.755; most accessible tissue: Zhenshan97 young leaf, score: 99.61 N N N N
vg0102177582 G -> DEL N N silent_mutation Average:95.755; most accessible tissue: Zhenshan97 young leaf, score: 99.61 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0102177582 G T -0.05 -0.02 -0.01 -0.04 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102177582 NA 4.42E-06 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102177582 NA 2.36E-07 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102177582 NA 2.09E-06 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102177582 NA 4.82E-06 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102177582 NA 1.16E-09 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102177582 NA 1.71E-15 mr1347_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102177582 NA 6.47E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102177582 NA 7.84E-07 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102177582 2.42E-06 5.24E-09 mr1406_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102177582 NA 3.25E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102177582 NA 2.46E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102177582 NA 1.51E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102177582 NA 2.75E-09 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102177582 NA 4.99E-11 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102177582 NA 6.16E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251