\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102141172:

Variant ID: vg0102141172 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2141172
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, C: 0.26, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GCAACATCAAATGGCCGAGTACATGTAGAAGCCAAATTCTAGGCATGATGTGGATCGTGCTAGTTGCATGAGTGCCATCGCCCCGTTCTTTACCCACAAG[T/C]
GGCTCGGGCATCCATGTCCTCTCCATGGGTGCTGCTGCAGAAAAGAGACGGGAGAAAGAAAGAGAAAAGATAGGATGAGGAAGAAGAAGGGACATTGACA

Reverse complement sequence

TGTCAATGTCCCTTCTTCTTCCTCATCCTATCTTTTCTCTTTCTTTCTCCCGTCTCTTTTCTGCAGCAGCACCCATGGAGAGGACATGGATGCCCGAGCC[A/G]
CTTGTGGGTAAAGAACGGGGCGATGGCACTCATGCAACTAGCACGATCCACATCATGCCTAGAATTTGGCTTCTACATGTACTCGGCCATTTGATGTTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.80% 37.80% 0.70% 14.71% NA
All Indica  2759 69.40% 27.40% 0.33% 2.83% NA
All Japonica  1512 8.30% 51.30% 1.19% 39.29% NA
Aus  269 35.70% 59.10% 0.37% 4.83% NA
Indica I  595 31.40% 68.40% 0.17% 0.00% NA
Indica II  465 92.50% 6.70% 0.22% 0.65% NA
Indica III  913 83.40% 12.00% 0.55% 4.05% NA
Indica Intermediate  786 68.40% 26.50% 0.25% 4.83% NA
Temperate Japonica  767 14.50% 79.90% 0.00% 5.61% NA
Tropical Japonica  504 1.80% 11.50% 1.79% 84.92% NA
Japonica Intermediate  241 2.10% 43.20% 3.73% 51.04% NA
VI/Aromatic  96 34.40% 65.60% 0.00% 0.00% NA
Intermediate  90 47.80% 35.60% 5.56% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102141172 T -> DEL N N silent_mutation Average:64.786; most accessible tissue: Minghui63 root, score: 86.792 N N N N
vg0102141172 T -> C LOC_Os01g04720.1 downstream_gene_variant ; 3862.0bp to feature; MODIFIER silent_mutation Average:64.786; most accessible tissue: Minghui63 root, score: 86.792 N N N N
vg0102141172 T -> C LOC_Os01g04730.1 downstream_gene_variant ; 2176.0bp to feature; MODIFIER silent_mutation Average:64.786; most accessible tissue: Minghui63 root, score: 86.792 N N N N
vg0102141172 T -> C LOC_Os01g04720.2 downstream_gene_variant ; 3862.0bp to feature; MODIFIER silent_mutation Average:64.786; most accessible tissue: Minghui63 root, score: 86.792 N N N N
vg0102141172 T -> C LOC_Os01g04740.1 intron_variant ; MODIFIER silent_mutation Average:64.786; most accessible tissue: Minghui63 root, score: 86.792 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0102141172 T C 0.0 -0.02 -0.01 -0.01 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102141172 NA 3.87E-13 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 2.43E-09 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 1.87E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 4.52E-07 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 6.15E-08 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 2.98E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 3.20E-07 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 2.86E-07 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 2.28E-08 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 6.63E-09 mr1419_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 9.39E-09 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 2.87E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 2.86E-09 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 4.50E-07 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 1.25E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 3.93E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 5.58E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 8.33E-09 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 1.53E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 8.43E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 6.67E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 6.66E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 1.37E-07 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 4.84E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 4.08E-11 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 4.91E-06 mr1811_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 2.71E-09 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 6.63E-15 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 2.85E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 6.43E-06 mr1894_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102141172 NA 6.87E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251