Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0102127805:

Variant ID: vg0102127805 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 2127805
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

TTTAAGTATATATCGATATAAGAATTATATATTGCTAATATCTACATCCGATCGAGTAGATTTAGTTCTTTATTATCTATTTACAACCGCCGATCGATTT[A/G]
CATATGACATCGGCTCAAAGATAAATGATATGTCATCGGCACCTAGCCGATCGACTATCGTTTATAGGTTTAACCGCGGTTTTCTTTGTTTCTATTTCTT

Reverse complement sequence

AAGAAATAGAAACAAAGAAAACCGCGGTTAAACCTATAAACGATAGTCGATCGGCTAGGTGCCGATGACATATCATTTATCTTTGAGCCGATGTCATATG[T/C]
AAATCGATCGGCGGTTGTAAATAGATAATAAAGAACTAAATCTACTCGATCGGATGTAGATATTAGCAATATATAATTCTTATATCGATATATACTTAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.00%	14.80%	2.12%	31.06%	NA
All Indica	2759	45.00%	3.30%	3.30%	48.39%	NA
All Japonica	1512	55.00%	37.90%	0.46%	6.61%	NA
Aus	269	89.20%	5.90%	0.37%	4.46%	NA
Indica I	595	71.10%	0.00%	2.35%	26.55%	NA
Indica II	465	37.40%	0.60%	4.09%	57.85%	NA
Indica III	913	34.70%	4.80%	2.85%	57.61%	NA
Indica Intermediate	786	41.60%	5.70%	4.07%	48.60%	NA
Temperate Japonica	767	81.50%	5.30%	0.65%	12.52%	NA
Tropical Japonica	504	12.90%	86.50%	0.20%	0.40%	NA
Japonica Intermediate	241	58.90%	39.80%	0.41%	0.83%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	58.90%	20.00%	1.11%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0102127805	A -> G	LOC_Os01g04720.1	upstream_gene_variant ; 2993.0bp to feature; MODIFIER	silent_mutation	Average:34.605; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg0102127805	A -> G	LOC_Os01g04720.2	upstream_gene_variant ; 2993.0bp to feature; MODIFIER	silent_mutation	Average:34.605; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg0102127805	A -> G	LOC_Os01g04710-LOC_Os01g04720	intergenic_region ; MODIFIER	silent_mutation	Average:34.605; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg0102127805	A -> DEL	N	N	silent_mutation	Average:34.605; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0102127805	NA	1.46E-07	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805	2.29E-06	NA	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805	NA	1.02E-15	mr1142	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805	NA	3.45E-14	mr1491	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805	NA	3.10E-06	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805	NA	5.73E-08	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805	NA	1.45E-11	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805	NA	1.44E-09	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805	NA	4.54E-07	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805	NA	8.86E-07	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805	NA	2.80E-06	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805	NA	4.52E-13	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805	NA	4.26E-07	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805	NA	2.07E-06	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805	NA	5.15E-13	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805	NA	4.60E-20	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805	NA	2.99E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251