Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102124242:

Variant ID: vg0102124242 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 2124242
Reference Allele: TC	Alternative Allele: CC,T
Primary Allele: TC	Secondary Allele: CC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACAATTACTCACGGTGTTGACAAAAACACCTCTAATTCCTACTCTAATCTTGTCGCGTACTACTTCCACTGTTTCACAATATAAGTTATTCTAGCATTT[TC/CC,T]
CATATTCATATTAATGTTAATGAATCTAGACATATATCAATATGAATATGAGAAATGCTAAAATAACTTATATTATAAAACGGAGGAAGTGCGTACAGTT

Reverse complement sequence

AACTGTACGCACTTCCTCCGTTTTATAATATAAGTTATTTTAGCATTTCTCATATTCATATTGATATATGTCTAGATTCATTAACATTAATATGAATATG[GA/GG,A]
AAATGCTAGAATAACTTATATTGTGAAACAGTGGAAGTAGTACGCGACAAGATTAGAGTAGGAATTAGAGGTGTTTTTGTCAACACCGTGAGTAATTGTA

Allele Frequencies:

Populations	Population Size	Frequency of TC(primary allele)	Frequency of CC(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.80%	19.60%	0.63%	33.88%	T: 0.04%
All Indica	2759	40.90%	5.60%	0.80%	52.66%	NA
All Japonica	1512	55.40%	36.90%	0.40%	7.34%	NA
Aus	269	34.90%	58.70%	0.37%	5.95%	NA
Indica I	595	70.60%	0.30%	0.50%	28.57%	NA
Indica II	465	31.00%	1.70%	0.65%	66.67%	NA
Indica III	913	32.00%	7.90%	0.66%	59.47%	NA
Indica Intermediate	786	34.70%	9.30%	1.27%	54.71%	NA
Temperate Japonica	767	73.00%	12.50%	0.52%	13.95%	NA
Tropical Japonica	504	17.50%	82.10%	0.00%	0.40%	NA
Japonica Intermediate	241	78.40%	19.90%	0.83%	0.83%	NA
VI/Aromatic	96	62.50%	34.40%	0.00%	3.12%	NA
Intermediate	90	51.10%	25.60%	1.11%	20.00%	T: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0102124242	TC -> CC	LOC_Os01g04710.1	downstream_gene_variant ; 1876.0bp to feature; MODIFIER	silent_mutation	Average:63.648; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0102124242	TC -> CC	LOC_Os01g04710-LOC_Os01g04720	intergenic_region ; MODIFIER	silent_mutation	Average:63.648; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0102124242	TC -> DEL	N	N	silent_mutation	Average:63.648; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0102124242	TC -> T	LOC_Os01g04710.1	downstream_gene_variant ; 1877.0bp to feature; MODIFIER	silent_mutation	Average:63.648; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0102124242	TC -> T	LOC_Os01g04710-LOC_Os01g04720	intergenic_region ; MODIFIER	silent_mutation	Average:63.648; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0102124242	NA	4.56E-08	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242	NA	8.87E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242	NA	3.25E-06	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242	NA	3.47E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242	NA	2.55E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242	NA	1.96E-07	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242	NA	4.51E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242	NA	5.79E-08	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242	NA	5.85E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242	NA	1.44E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242	NA	4.44E-08	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242	1.89E-06	1.89E-06	mr1574_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242	NA	9.28E-06	mr1597_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242	NA	1.12E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242	NA	5.80E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242	NA	4.49E-06	mr1736_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242	NA	2.04E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251