\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102124242:

Variant ID: vg0102124242 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 2124242
Reference Allele: TCAlternative Allele: CC,T
Primary Allele: TCSecondary Allele: CC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACAATTACTCACGGTGTTGACAAAAACACCTCTAATTCCTACTCTAATCTTGTCGCGTACTACTTCCACTGTTTCACAATATAAGTTATTCTAGCATTT[TC/CC,T]
CATATTCATATTAATGTTAATGAATCTAGACATATATCAATATGAATATGAGAAATGCTAAAATAACTTATATTATAAAACGGAGGAAGTGCGTACAGTT

Reverse complement sequence

AACTGTACGCACTTCCTCCGTTTTATAATATAAGTTATTTTAGCATTTCTCATATTCATATTGATATATGTCTAGATTCATTAACATTAATATGAATATG[GA/GG,A]
AAATGCTAGAATAACTTATATTGTGAAACAGTGGAAGTAGTACGCGACAAGATTAGAGTAGGAATTAGAGGTGTTTTTGTCAACACCGTGAGTAATTGTA

Allele Frequencies:

Populations Population SizeFrequency of TC(primary allele) Frequency of CC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.80% 19.60% 0.63% 33.88% T: 0.04%
All Indica  2759 40.90% 5.60% 0.80% 52.66% NA
All Japonica  1512 55.40% 36.90% 0.40% 7.34% NA
Aus  269 34.90% 58.70% 0.37% 5.95% NA
Indica I  595 70.60% 0.30% 0.50% 28.57% NA
Indica II  465 31.00% 1.70% 0.65% 66.67% NA
Indica III  913 32.00% 7.90% 0.66% 59.47% NA
Indica Intermediate  786 34.70% 9.30% 1.27% 54.71% NA
Temperate Japonica  767 73.00% 12.50% 0.52% 13.95% NA
Tropical Japonica  504 17.50% 82.10% 0.00% 0.40% NA
Japonica Intermediate  241 78.40% 19.90% 0.83% 0.83% NA
VI/Aromatic  96 62.50% 34.40% 0.00% 3.12% NA
Intermediate  90 51.10% 25.60% 1.11% 20.00% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102124242 TC -> CC LOC_Os01g04710.1 downstream_gene_variant ; 1876.0bp to feature; MODIFIER silent_mutation Average:63.648; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0102124242 TC -> CC LOC_Os01g04710-LOC_Os01g04720 intergenic_region ; MODIFIER silent_mutation Average:63.648; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0102124242 TC -> DEL N N silent_mutation Average:63.648; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0102124242 TC -> T LOC_Os01g04710.1 downstream_gene_variant ; 1877.0bp to feature; MODIFIER silent_mutation Average:63.648; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0102124242 TC -> T LOC_Os01g04710-LOC_Os01g04720 intergenic_region ; MODIFIER silent_mutation Average:63.648; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102124242 NA 4.56E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242 NA 8.87E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242 NA 3.25E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242 NA 3.47E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242 NA 2.55E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242 NA 1.96E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242 NA 4.51E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242 NA 5.79E-08 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242 NA 5.85E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242 NA 1.44E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242 NA 4.44E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242 1.89E-06 1.89E-06 mr1574_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242 NA 9.28E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242 NA 1.12E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242 NA 5.80E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242 NA 4.49E-06 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102124242 NA 2.04E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251