\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102116611:

Variant ID: vg0102116611 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2116611
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, C: 0.28, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AAGATTGACAGCGTAAGGATAAAGTTACTAGATTTATCATGAAATAAAACTATAATACTCCCTCATTCCCTAAATGTTTGACGCCATTGATTCTTTTAAA[T/C]
ATGTTTGACCATTCGTCTTATTCAAAAATTTTTGTGAAATGTGTAAAACTATATGTATACATAAAAGTATATTTAACAATAAATCAAATGATAGGAAAAG

Reverse complement sequence

CTTTTCCTATCATTTGATTTATTGTTAAATATACTTTTATGTATACATATAGTTTTACACATTTCACAAAAATTTTTGAATAAGACGAATGGTCAAACAT[A/G]
TTTAAAAGAATCAATGGCGTCAAACATTTAGGGAATGAGGGAGTATTATAGTTTTATTTCATGATAAATCTAGTAACTTTATCCTTACGCTGTCAATCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 38.90% 0.13% 0.13% NA
All Indica  2759 77.10% 22.50% 0.18% 0.22% NA
All Japonica  1512 43.30% 56.70% 0.00% 0.00% NA
Aus  269 7.80% 92.20% 0.00% 0.00% NA
Indica I  595 96.60% 3.20% 0.17% 0.00% NA
Indica II  465 73.30% 26.50% 0.00% 0.22% NA
Indica III  913 67.70% 32.00% 0.11% 0.22% NA
Indica Intermediate  786 75.30% 23.90% 0.38% 0.38% NA
Temperate Japonica  767 66.10% 33.90% 0.00% 0.00% NA
Tropical Japonica  504 4.20% 95.80% 0.00% 0.00% NA
Japonica Intermediate  241 52.30% 47.70% 0.00% 0.00% NA
VI/Aromatic  96 33.30% 66.70% 0.00% 0.00% NA
Intermediate  90 48.90% 50.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102116611 T -> DEL N N silent_mutation Average:49.216; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0102116611 T -> C LOC_Os01g04699.1 upstream_gene_variant ; 4960.0bp to feature; MODIFIER silent_mutation Average:49.216; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0102116611 T -> C LOC_Os01g04710.1 upstream_gene_variant ; 3770.0bp to feature; MODIFIER silent_mutation Average:49.216; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0102116611 T -> C LOC_Os01g04699-LOC_Os01g04710 intergenic_region ; MODIFIER silent_mutation Average:49.216; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102116611 NA 1.66E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 3.81E-06 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 7.32E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 1.86E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 4.96E-06 4.96E-06 mr1147_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 1.73E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 2.68E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 2.28E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 6.06E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 1.12E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 1.01E-07 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 6.73E-06 mr1428_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 2.05E-06 2.05E-06 mr1440_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 9.52E-08 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 9.39E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 9.74E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 9.30E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 5.26E-11 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 7.71E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 1.26E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 9.07E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 NA 3.70E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 8.54E-07 8.53E-07 mr1972_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116611 1.68E-06 1.68E-06 mr1972_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251