Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102116003:

Variant ID: vg0102116003 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 2116003
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTCACAGAAATAGATCATACCAATTTACTAAGAATTGTAATTTTATAACCATATTCCTTATAATCTTTAGCACGAGGTAAGACCTCTTGAAAAAATTTC[T/C]
ATGGATTAGAGTGCATGTAACATTCCAATTATTTACTTTTTATATTCCTGTGATTTGAAAATACTTCTAATCGAATAAGCTCATGTATTCTCAAACGGAG

Reverse complement sequence

CTCCGTTTGAGAATACATGAGCTTATTCGATTAGAAGTATTTTCAAATCACAGGAATATAAAAAGTAAATAATTGGAATGTTACATGCACTCTAATCCAT[A/G]
GAAATTTTTTCAAGAGGTCTTACCTCGTGCTAAAGATTATAAGGAATATGGTTATAAAATTACAATTCTTAGTAAATTGGTATGATCTATTTCTGTGAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.40%	5.60%	0.02%	0.00%	NA
All Indica	2759	96.80%	3.20%	0.00%	0.00%	NA
All Japonica	1512	89.50%	10.40%	0.07%	0.00%	NA
Aus	269	92.90%	7.10%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	94.60%	5.40%	0.00%	0.00%	NA
Indica Intermediate	786	95.40%	4.60%	0.00%	0.00%	NA
Temperate Japonica	767	95.40%	4.60%	0.00%	0.00%	NA
Tropical Japonica	504	87.10%	12.70%	0.20%	0.00%	NA
Japonica Intermediate	241	75.50%	24.50%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0102116003	T -> C	LOC_Os01g04699.1	upstream_gene_variant ; 4352.0bp to feature; MODIFIER	silent_mutation	Average:65.157; most accessible tissue: Callus, score: 98.992	N	N	N	N
vg0102116003	T -> C	LOC_Os01g04710.1	upstream_gene_variant ; 4378.0bp to feature; MODIFIER	silent_mutation	Average:65.157; most accessible tissue: Callus, score: 98.992	N	N	N	N
vg0102116003	T -> C	LOC_Os01g04699-LOC_Os01g04710	intergenic_region ; MODIFIER	silent_mutation	Average:65.157; most accessible tissue: Callus, score: 98.992	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0102116003	7.77E-09	NA	mr1023	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116003	2.71E-06	NA	mr1023	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116003	3.72E-07	NA	mr1079	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116003	7.13E-08	NA	mr1142	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116003	2.02E-06	NA	mr1142	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116003	1.21E-08	NA	mr1489	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116003	4.31E-08	NA	mr1491	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116003	9.28E-06	NA	mr1491	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116003	1.41E-07	NA	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251