\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102113150:

Variant ID: vg0102113150 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2113150
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCCGCATAAATTTCCAAGTACGCCTTGTTTAGTACCAAAATAATTTTTCAAACTTCTAACTTTTCTATCACATTAAAACTTTTCTACACACATAAACTT[C/T]
CAAATTTTCTATCACATCGTTCCAATTTAAATCAAATTTTTAATTTTAGTGTGAACTAAAACACAACTGTAATCGAGTGAGGCCTGAGAATGTCTGCGTG

Reverse complement sequence

CACGCAGACATTCTCAGGCCTCACTCGATTACAGTTGTGTTTTAGTTCACACTAAAATTAAAAATTTGATTTAAATTGGAACGATGTGATAGAAAATTTG[G/A]
AAGTTTATGTGTGTAGAAAAGTTTTAATGTGATAGAAAAGTTAGAAGTTTGAAAAATTATTTTGGTACTAAACAAGGCGTACTTGGAAATTTATGCGGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.30% 18.70% 0.06% 5.95% NA
All Indica  2759 93.80% 4.60% 0.04% 1.59% NA
All Japonica  1512 48.50% 45.60% 0.13% 5.69% NA
Aus  269 42.40% 2.20% 0.00% 55.39% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 98.10% 1.70% 0.00% 0.22% NA
Indica III  913 92.10% 4.10% 0.00% 3.83% NA
Indica Intermediate  786 89.70% 9.20% 0.13% 1.02% NA
Temperate Japonica  767 68.60% 28.90% 0.13% 2.35% NA
Tropical Japonica  504 13.70% 82.70% 0.20% 3.37% NA
Japonica Intermediate  241 57.70% 21.20% 0.00% 21.16% NA
VI/Aromatic  96 64.60% 33.30% 0.00% 2.08% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102113150 C -> T LOC_Os01g04690.1 upstream_gene_variant ; 3515.0bp to feature; MODIFIER silent_mutation Average:56.331; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N
vg0102113150 C -> T LOC_Os01g04699.1 upstream_gene_variant ; 1499.0bp to feature; MODIFIER silent_mutation Average:56.331; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N
vg0102113150 C -> T LOC_Os01g04699-LOC_Os01g04710 intergenic_region ; MODIFIER silent_mutation Average:56.331; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N
vg0102113150 C -> DEL N N silent_mutation Average:56.331; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0102113150 C T 0.04 0.0 0.0 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102113150 9.35E-06 9.35E-06 mr1053_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 9.62E-06 9.62E-06 mr1074_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 4.08E-06 NA mr1081_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 2.43E-10 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 1.81E-14 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 1.16E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 8.14E-07 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 7.38E-06 7.38E-06 mr1147_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 7.24E-06 NA mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 1.38E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 1.49E-10 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 1.59E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 9.36E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 3.45E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 2.23E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 1.54E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 4.46E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 3.14E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 1.07E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 3.07E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 2.45E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 9.69E-06 6.92E-06 mr1440_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 2.71E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 2.84E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 9.21E-08 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 7.23E-08 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 3.92E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 1.20E-07 NA mr1889_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 5.78E-07 5.78E-07 mr1889_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113150 NA 3.43E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251