\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102110704:

Variant ID: vg0102110704 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2110704
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.16, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTTTACTAAATAACAGAGGAAATAGAAGTCATTCAAATGAAATGATTTGATATGCTACTTAGAGCAAGGCTAATAGTATAGCCCACTGCTGGCTAATA[G/A]
CCCACTCCTAAAGCCAACTATAGGTACAATAGCTTATTCATTGGATGACTACATCTTATAATCAAATAATTAATTATAACATGTACATGTCAATGTGTAG

Reverse complement sequence

CTACACATTGACATGTACATGTTATAATTAATTATTTGATTATAAGATGTAGTCATCCAATGAATAAGCTATTGTACCTATAGTTGGCTTTAGGAGTGGG[C/T]
TATTAGCCAGCAGTGGGCTATACTATTAGCCTTGCTCTAAGTAGCATATCAAATCATTTCATTTGAATGACTTCTATTTCCTCTGTTATTTAGTAAAGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.80% 33.30% 0.32% 5.56% NA
All Indica  2759 77.10% 21.10% 0.25% 1.52% NA
All Japonica  1512 43.10% 51.30% 0.07% 5.49% NA
Aus  269 7.80% 39.00% 2.23% 50.93% NA
Indica I  595 96.80% 3.20% 0.00% 0.00% NA
Indica II  465 73.10% 26.70% 0.00% 0.22% NA
Indica III  913 67.70% 28.30% 0.44% 3.61% NA
Indica Intermediate  786 75.60% 23.00% 0.38% 1.02% NA
Temperate Japonica  767 65.80% 31.90% 0.00% 2.22% NA
Tropical Japonica  504 4.20% 92.50% 0.00% 3.37% NA
Japonica Intermediate  241 52.30% 27.00% 0.41% 20.33% NA
VI/Aromatic  96 33.30% 64.60% 1.04% 1.04% NA
Intermediate  90 44.40% 55.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102110704 G -> A LOC_Os01g04690.1 upstream_gene_variant ; 1069.0bp to feature; MODIFIER silent_mutation Average:56.832; most accessible tissue: Zhenshan97 flower, score: 73.414 N N N N
vg0102110704 G -> A LOC_Os01g04680.1 downstream_gene_variant ; 2865.0bp to feature; MODIFIER silent_mutation Average:56.832; most accessible tissue: Zhenshan97 flower, score: 73.414 N N N N
vg0102110704 G -> A LOC_Os01g04699.1 downstream_gene_variant ; 322.0bp to feature; MODIFIER silent_mutation Average:56.832; most accessible tissue: Zhenshan97 flower, score: 73.414 N N N N
vg0102110704 G -> A LOC_Os01g04690-LOC_Os01g04699 intergenic_region ; MODIFIER silent_mutation Average:56.832; most accessible tissue: Zhenshan97 flower, score: 73.414 N N N N
vg0102110704 G -> DEL N N silent_mutation Average:56.832; most accessible tissue: Zhenshan97 flower, score: 73.414 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102110704 NA 2.74E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 NA 7.64E-06 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 NA 3.91E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 6.30E-06 6.30E-06 mr1147_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 NA 4.98E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 NA 3.89E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 NA 4.83E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 NA 8.82E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 NA 2.57E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 NA 2.80E-07 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 NA 1.16E-06 mr1428_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 3.73E-06 3.73E-06 mr1440_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 NA 2.29E-07 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 NA 3.13E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 NA 3.86E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 NA 4.48E-11 mr1671_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 NA 8.43E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 NA 3.32E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 NA 1.35E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 NA 8.33E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 2.33E-06 2.32E-06 mr1972_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704 2.82E-06 2.82E-06 mr1972_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251