Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102110704:

Variant ID: vg0102110704 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 2110704
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.16, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTTTACTAAATAACAGAGGAAATAGAAGTCATTCAAATGAAATGATTTGATATGCTACTTAGAGCAAGGCTAATAGTATAGCCCACTGCTGGCTAATA[G/A]
CCCACTCCTAAAGCCAACTATAGGTACAATAGCTTATTCATTGGATGACTACATCTTATAATCAAATAATTAATTATAACATGTACATGTCAATGTGTAG

Reverse complement sequence

CTACACATTGACATGTACATGTTATAATTAATTATTTGATTATAAGATGTAGTCATCCAATGAATAAGCTATTGTACCTATAGTTGGCTTTAGGAGTGGG[C/T]
TATTAGCCAGCAGTGGGCTATACTATTAGCCTTGCTCTAAGTAGCATATCAAATCATTTCATTTGAATGACTTCTATTTCCTCTGTTATTTAGTAAAGAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.80%	33.30%	0.32%	5.56%	NA
All Indica	2759	77.10%	21.10%	0.25%	1.52%	NA
All Japonica	1512	43.10%	51.30%	0.07%	5.49%	NA
Aus	269	7.80%	39.00%	2.23%	50.93%	NA
Indica I	595	96.80%	3.20%	0.00%	0.00%	NA
Indica II	465	73.10%	26.70%	0.00%	0.22%	NA
Indica III	913	67.70%	28.30%	0.44%	3.61%	NA
Indica Intermediate	786	75.60%	23.00%	0.38%	1.02%	NA
Temperate Japonica	767	65.80%	31.90%	0.00%	2.22%	NA
Tropical Japonica	504	4.20%	92.50%	0.00%	3.37%	NA
Japonica Intermediate	241	52.30%	27.00%	0.41%	20.33%	NA
VI/Aromatic	96	33.30%	64.60%	1.04%	1.04%	NA
Intermediate	90	44.40%	55.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0102110704	G -> A	LOC_Os01g04690.1	upstream_gene_variant ; 1069.0bp to feature; MODIFIER	silent_mutation	Average:56.832; most accessible tissue: Zhenshan97 flower, score: 73.414	N	N	N	N
vg0102110704	G -> A	LOC_Os01g04680.1	downstream_gene_variant ; 2865.0bp to feature; MODIFIER	silent_mutation	Average:56.832; most accessible tissue: Zhenshan97 flower, score: 73.414	N	N	N	N
vg0102110704	G -> A	LOC_Os01g04699.1	downstream_gene_variant ; 322.0bp to feature; MODIFIER	silent_mutation	Average:56.832; most accessible tissue: Zhenshan97 flower, score: 73.414	N	N	N	N
vg0102110704	G -> A	LOC_Os01g04690-LOC_Os01g04699	intergenic_region ; MODIFIER	silent_mutation	Average:56.832; most accessible tissue: Zhenshan97 flower, score: 73.414	N	N	N	N
vg0102110704	G -> DEL	N	N	silent_mutation	Average:56.832; most accessible tissue: Zhenshan97 flower, score: 73.414	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0102110704	NA	2.74E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	NA	7.64E-06	mr1092_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	NA	3.91E-06	mr1129_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	6.30E-06	6.30E-06	mr1147_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	NA	4.98E-06	mr1204_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	NA	3.89E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	NA	4.83E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	NA	8.82E-08	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	NA	2.57E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	NA	2.80E-07	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	NA	1.16E-06	mr1428_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	3.73E-06	3.73E-06	mr1440_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	NA	2.29E-07	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	NA	3.13E-10	mr1580_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	NA	3.86E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	NA	4.48E-11	mr1671_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	NA	8.43E-06	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	NA	3.32E-10	mr1825_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	NA	1.35E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	NA	8.33E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	2.33E-06	2.32E-06	mr1972_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110704	2.82E-06	2.82E-06	mr1972_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251