\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102110353:

Variant ID: vg0102110353 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2110353
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.63, G: 0.37, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TATACTACGACGAAAATATTTCTTGAGCACTAATTTAATGCACGAACAAATTCCATACATTCTCTAGCCAATCGGATACTTAAGAAGTCTAAGCAAATCA[A/G]
TATTTAAAATTTGACCAATAAGGTGACTGCAGGGACGGATCCAACGTGGGTGCAGGGCCCCTCTACACCCACAAGATCCATGGATACCCCCGGAGCACCC

Reverse complement sequence

GGGTGCTCCGGGGGTATCCATGGATCTTGTGGGTGTAGAGGGGCCCTGCACCCACGTTGGATCCGTCCCTGCAGTCACCTTATTGGTCAAATTTTAAATA[T/C]
TGATTTGCTTAGACTTCTTAAGTATCCGATTGGCTAGAGAATGTATGGAATTTGTTCGTGCATTAAATTAGTGCTCAAGAAATATTTTCGTCGTAGTATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 33.20% 0.59% 5.29% NA
All Indica  2759 77.10% 21.10% 0.33% 1.41% NA
All Japonica  1512 43.30% 51.30% 0.73% 4.70% NA
Aus  269 8.60% 37.20% 2.60% 51.67% NA
Indica I  595 96.80% 3.20% 0.00% 0.00% NA
Indica II  465 73.30% 26.50% 0.00% 0.22% NA
Indica III  913 67.70% 28.30% 0.66% 3.40% NA
Indica Intermediate  786 75.40% 23.30% 0.38% 0.89% NA
Temperate Japonica  767 66.00% 31.90% 0.00% 2.09% NA
Tropical Japonica  504 4.20% 92.50% 0.79% 2.58% NA
Japonica Intermediate  241 52.70% 27.00% 2.90% 17.43% NA
VI/Aromatic  96 33.30% 64.60% 1.04% 1.04% NA
Intermediate  90 46.70% 53.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102110353 A -> G LOC_Os01g04690.1 upstream_gene_variant ; 718.0bp to feature; MODIFIER silent_mutation Average:60.15; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0102110353 A -> G LOC_Os01g04680.1 downstream_gene_variant ; 2514.0bp to feature; MODIFIER silent_mutation Average:60.15; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0102110353 A -> G LOC_Os01g04699.1 downstream_gene_variant ; 673.0bp to feature; MODIFIER silent_mutation Average:60.15; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0102110353 A -> G LOC_Os01g04690-LOC_Os01g04699 intergenic_region ; MODIFIER silent_mutation Average:60.15; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0102110353 A -> DEL N N silent_mutation Average:60.15; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102110353 NA 1.66E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 6.71E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 3.81E-06 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 7.32E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 1.86E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 4.96E-06 4.96E-06 mr1147_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 1.73E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 7.52E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 2.28E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 6.06E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 1.12E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 2.71E-06 mr1320_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 1.01E-07 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 6.73E-06 mr1428_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 2.05E-06 2.05E-06 mr1440_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 9.52E-08 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 9.39E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 9.74E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 5.26E-11 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 7.71E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 1.26E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 9.07E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 NA 3.70E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 5.44E-06 5.44E-06 mr1972_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353 1.68E-06 1.68E-06 mr1972_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251