Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102110353:

Variant ID: vg0102110353 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 2110353
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.63, G: 0.37, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TATACTACGACGAAAATATTTCTTGAGCACTAATTTAATGCACGAACAAATTCCATACATTCTCTAGCCAATCGGATACTTAAGAAGTCTAAGCAAATCA[A/G]
TATTTAAAATTTGACCAATAAGGTGACTGCAGGGACGGATCCAACGTGGGTGCAGGGCCCCTCTACACCCACAAGATCCATGGATACCCCCGGAGCACCC

Reverse complement sequence

GGGTGCTCCGGGGGTATCCATGGATCTTGTGGGTGTAGAGGGGCCCTGCACCCACGTTGGATCCGTCCCTGCAGTCACCTTATTGGTCAAATTTTAAATA[T/C]
TGATTTGCTTAGACTTCTTAAGTATCCGATTGGCTAGAGAATGTATGGAATTTGTTCGTGCATTAAATTAGTGCTCAAGAAATATTTTCGTCGTAGTATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.90%	33.20%	0.59%	5.29%	NA
All Indica	2759	77.10%	21.10%	0.33%	1.41%	NA
All Japonica	1512	43.30%	51.30%	0.73%	4.70%	NA
Aus	269	8.60%	37.20%	2.60%	51.67%	NA
Indica I	595	96.80%	3.20%	0.00%	0.00%	NA
Indica II	465	73.30%	26.50%	0.00%	0.22%	NA
Indica III	913	67.70%	28.30%	0.66%	3.40%	NA
Indica Intermediate	786	75.40%	23.30%	0.38%	0.89%	NA
Temperate Japonica	767	66.00%	31.90%	0.00%	2.09%	NA
Tropical Japonica	504	4.20%	92.50%	0.79%	2.58%	NA
Japonica Intermediate	241	52.70%	27.00%	2.90%	17.43%	NA
VI/Aromatic	96	33.30%	64.60%	1.04%	1.04%	NA
Intermediate	90	46.70%	53.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0102110353	A -> G	LOC_Os01g04690.1	upstream_gene_variant ; 718.0bp to feature; MODIFIER	silent_mutation	Average:60.15; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0102110353	A -> G	LOC_Os01g04680.1	downstream_gene_variant ; 2514.0bp to feature; MODIFIER	silent_mutation	Average:60.15; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0102110353	A -> G	LOC_Os01g04699.1	downstream_gene_variant ; 673.0bp to feature; MODIFIER	silent_mutation	Average:60.15; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0102110353	A -> G	LOC_Os01g04690-LOC_Os01g04699	intergenic_region ; MODIFIER	silent_mutation	Average:60.15; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0102110353	A -> DEL	N	N	silent_mutation	Average:60.15; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0102110353	NA	1.66E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	6.71E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	3.81E-06	mr1092_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	7.32E-07	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	1.86E-06	mr1129_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	4.96E-06	4.96E-06	mr1147_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	1.73E-06	mr1204_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	7.52E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	2.28E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	6.06E-08	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	1.12E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	2.71E-06	mr1320_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	1.01E-07	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	6.73E-06	mr1428_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	2.05E-06	2.05E-06	mr1440_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	9.52E-08	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	9.39E-11	mr1580_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	9.74E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	5.26E-11	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	7.71E-06	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	1.26E-10	mr1825_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	9.07E-08	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	NA	3.70E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	5.44E-06	5.44E-06	mr1972_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102110353	1.68E-06	1.68E-06	mr1972_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251