\
| Variant ID: vg0102107447 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 2107447 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 227. )
CACAGCTACAAACTTCAATAACCTGATTTGGAAGCCGTGGGCGCCGCATAAGTGCAAAACCTTCGCATGGTTGATCATCCAAAACAGAGTCTGGACATCC[A/G]
ACAGACTGGCCACCAGGGGTTGGCCGAATGGATCCATCTGTCCCTTATGTCGCCATCGCCAAGAGACAGCCATCCACCTCCTCGCGGAGTGTAGATACAC
GTGTATCTACACTCCGCGAGGAGGTGGATGGCTGTCTCTTGGCGATGGCGACATAAGGGACAGATGGATCCATTCGGCCAACCCCTGGTGGCCAGTCTGT[T/C]
GGATGTCCAGACTCTGTTTTGGATGATCAACCATGCGAAGGTTTTGCACTTATGCGGCGCCCACGGCTTCCAAATCAGGTTATTGAAGTTTGTAGCTGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.70% | 31.20% | 0.06% | 4.02% | NA |
| All Indica | 2759 | 71.40% | 24.80% | 0.11% | 3.66% | NA |
| All Japonica | 1512 | 47.00% | 48.30% | 0.00% | 4.63% | NA |
| Aus | 269 | 91.10% | 2.20% | 0.00% | 6.69% | NA |
| Indica I | 595 | 31.60% | 67.70% | 0.00% | 0.67% | NA |
| Indica II | 465 | 93.30% | 5.80% | 0.22% | 0.65% | NA |
| Indica III | 913 | 86.90% | 7.40% | 0.11% | 5.59% | NA |
| Indica Intermediate | 786 | 70.70% | 23.70% | 0.13% | 5.47% | NA |
| Temperate Japonica | 767 | 41.30% | 56.60% | 0.00% | 2.09% | NA |
| Tropical Japonica | 504 | 66.10% | 25.20% | 0.00% | 8.73% | NA |
| Japonica Intermediate | 241 | 25.30% | 70.50% | 0.00% | 4.15% | NA |
| VI/Aromatic | 96 | 72.90% | 27.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 32.20% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0102107447 | A -> G | LOC_Os01g04680.1 | missense_variant ; p.Asn290Asp; MODERATE | nonsynonymous_codon | Average:62.589; most accessible tissue: Zhenshan97 young leaf, score: 76.773 | possibly damaging |
-1.641 |
TOLERATED | 1.00 |
| vg0102107447 | A -> DEL | LOC_Os01g04680.1 | N | frameshift_variant | Average:62.589; most accessible tissue: Zhenshan97 young leaf, score: 76.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0102107447 | NA | 2.24E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | NA | 9.61E-07 | mr1041_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | NA | 6.22E-07 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | NA | 3.89E-06 | mr1284_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | NA | 9.30E-06 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | NA | 4.18E-06 | mr1374_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | NA | 7.58E-06 | mr1402_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | 6.59E-06 | 6.61E-06 | mr1412_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | NA | 6.77E-06 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | NA | 7.97E-06 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | NA | 3.16E-06 | mr1633_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | NA | 1.00E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | NA | 1.63E-06 | mr1687_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | NA | 6.77E-07 | mr1706_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | NA | 1.73E-06 | mr1759_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | 2.55E-06 | 2.55E-06 | mr1766_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | NA | 4.11E-07 | mr1811_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | NA | 2.08E-06 | mr1816_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | NA | 1.64E-06 | mr1823_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102107447 | NA | 4.54E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |