Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102107447:

Variant ID: vg0102107447 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 2107447
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

CACAGCTACAAACTTCAATAACCTGATTTGGAAGCCGTGGGCGCCGCATAAGTGCAAAACCTTCGCATGGTTGATCATCCAAAACAGAGTCTGGACATCC[A/G]
ACAGACTGGCCACCAGGGGTTGGCCGAATGGATCCATCTGTCCCTTATGTCGCCATCGCCAAGAGACAGCCATCCACCTCCTCGCGGAGTGTAGATACAC

Reverse complement sequence

GTGTATCTACACTCCGCGAGGAGGTGGATGGCTGTCTCTTGGCGATGGCGACATAAGGGACAGATGGATCCATTCGGCCAACCCCTGGTGGCCAGTCTGT[T/C]
GGATGTCCAGACTCTGTTTTGGATGATCAACCATGCGAAGGTTTTGCACTTATGCGGCGCCCACGGCTTCCAAATCAGGTTATTGAAGTTTGTAGCTGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.70%	31.20%	0.06%	4.02%	NA
All Indica	2759	71.40%	24.80%	0.11%	3.66%	NA
All Japonica	1512	47.00%	48.30%	0.00%	4.63%	NA
Aus	269	91.10%	2.20%	0.00%	6.69%	NA
Indica I	595	31.60%	67.70%	0.00%	0.67%	NA
Indica II	465	93.30%	5.80%	0.22%	0.65%	NA
Indica III	913	86.90%	7.40%	0.11%	5.59%	NA
Indica Intermediate	786	70.70%	23.70%	0.13%	5.47%	NA
Temperate Japonica	767	41.30%	56.60%	0.00%	2.09%	NA
Tropical Japonica	504	66.10%	25.20%	0.00%	8.73%	NA
Japonica Intermediate	241	25.30%	70.50%	0.00%	4.15%	NA
VI/Aromatic	96	72.90%	27.10%	0.00%	0.00%	NA
Intermediate	90	66.70%	32.20%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0102107447	A -> G	LOC_Os01g04680.1	missense_variant ; p.Asn290Asp; MODERATE	nonsynonymous_codon	Average:62.589; most accessible tissue: Zhenshan97 young leaf, score: 76.773	possibly damaging	-1.641	TOLERATED	1.00
vg0102107447	A -> DEL	LOC_Os01g04680.1	N	frameshift_variant	Average:62.589; most accessible tissue: Zhenshan97 young leaf, score: 76.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0102107447	NA	2.24E-06	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	NA	9.61E-07	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	NA	6.22E-07	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	NA	3.89E-06	mr1284_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	NA	9.30E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	NA	4.18E-06	mr1374_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	NA	7.58E-06	mr1402_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	6.59E-06	6.61E-06	mr1412_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	NA	6.77E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	NA	7.97E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	NA	3.16E-06	mr1633_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	NA	1.00E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	NA	1.63E-06	mr1687_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	NA	6.77E-07	mr1706_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	NA	1.73E-06	mr1759_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	2.55E-06	2.55E-06	mr1766_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	NA	4.11E-07	mr1811_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	NA	2.08E-06	mr1816_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	NA	1.64E-06	mr1823_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102107447	NA	4.54E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251