\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102106039:

Variant ID: vg0102106039 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2106039
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, G: 0.38, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TAGATCCTTAGCAGCCTGAGAAAATTGTTCCATCGTACAAAAGGTCCCATCGTTTGGCTTATTCGCCAAACGATATATTTGCAAACAAAAAGTAATTTAT[A/G]
AATAAAACTTATATACGTGTTCTTAGCGACCTAAAAGCAAAGGCTGAAAAGTAAACTTCGATGAAAAAACCCTAAAATCAACGTCAAATTTAAGGTTGAA

Reverse complement sequence

TTCAACCTTAAATTTGACGTTGATTTTAGGGTTTTTTCATCGAAGTTTACTTTTCAGCCTTTGCTTTTAGGTCGCTAAGAACACGTATATAAGTTTTATT[T/C]
ATAAATTACTTTTTGTTTGCAAATATATCGTTTGGCGAATAAGCCAAACGATGGGACCTTTTGTACGATGGAACAATTTTCTCAGGCTGCTAAGGATCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.40% 31.30% 0.04% 0.32% NA
All Indica  2759 74.60% 24.80% 0.07% 0.54% NA
All Japonica  1512 51.70% 48.30% 0.00% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 31.80% 67.70% 0.00% 0.50% NA
Indica II  465 93.80% 5.80% 0.22% 0.22% NA
Indica III  913 92.20% 7.40% 0.00% 0.33% NA
Indica Intermediate  786 75.10% 23.80% 0.13% 1.02% NA
Temperate Japonica  767 43.40% 56.60% 0.00% 0.00% NA
Tropical Japonica  504 74.80% 25.20% 0.00% 0.00% NA
Japonica Intermediate  241 29.50% 70.50% 0.00% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102106039 A -> G LOC_Os01g04670.1 upstream_gene_variant ; 3367.0bp to feature; MODIFIER silent_mutation Average:53.475; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg0102106039 A -> G LOC_Os01g04690.1 downstream_gene_variant ; 2908.0bp to feature; MODIFIER silent_mutation Average:53.475; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg0102106039 A -> G LOC_Os01g04699.1 downstream_gene_variant ; 4987.0bp to feature; MODIFIER silent_mutation Average:53.475; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg0102106039 A -> G LOC_Os01g04680.1 intron_variant ; MODIFIER silent_mutation Average:53.475; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg0102106039 A -> DEL N N silent_mutation Average:53.475; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102106039 NA 1.34E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 3.02E-07 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 2.68E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 7.78E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 2.63E-06 mr1284_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 4.74E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 3.41E-06 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 8.99E-06 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 2.86E-06 2.87E-06 mr1412_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 2.56E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 2.23E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 9.98E-06 mr1466_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 5.71E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 8.72E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 3.69E-06 mr1494_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 4.92E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 1.79E-06 mr1633_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 4.76E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 8.21E-06 7.98E-07 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 1.44E-07 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 6.71E-07 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 5.64E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 3.88E-06 3.87E-06 mr1766_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 2.51E-07 mr1811_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 1.49E-06 mr1816_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 9.89E-06 3.83E-07 mr1823_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 9.99E-08 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 7.55E-06 mr1832_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 5.37E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 3.58E-06 mr1894_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102106039 NA 6.18E-06 mr1976_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251