Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0102103204:

Variant ID: vg0102103204 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2103204
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.56, C: 0.45, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AATCATATTATGCACCGGGCTGACCTTACCGTTGTTTGCTCGCTTGGGGACAGAGTCGATCCTCGCTTACCAGCTTGACAAGTTTGACACCGGGGAGAAA[C/A]
TGAACGGAGTAGGAACTTATTCTCTTATTATTATACGGAGAATTTATATTAGAATTTTTTTTTAAGACGATGGAACCGTAACTTCTGACCTCTGTACCTA

Reverse complement sequence

TAGGTACAGAGGTCAGAAGTTACGGTTCCATCGTCTTAAAAAAAAATTCTAATATAAATTCTCCGTATAATAATAAGAGAATAAGTTCCTACTCCGTTCA[G/T]
TTTCTCCCCGGTGTCAAACTTGTCAAGCTGGTAAGCGAGGATCGACTCTGTCCCCAAGCGAGCAAACAACGGTAAGGTCAGCCCGGTGCATAATATGATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.50% 23.00% 0.23% 0.30% NA
All Indica  2759 75.00% 24.20% 0.22% 0.51% NA
All Japonica  1512 73.90% 25.90% 0.20% 0.00% NA
Aus  269 98.10% 1.50% 0.37% 0.00% NA
Indica I  595 32.10% 67.40% 0.17% 0.34% NA
Indica II  465 94.20% 5.20% 0.22% 0.43% NA
Indica III  913 92.80% 7.00% 0.00% 0.22% NA
Indica Intermediate  786 75.60% 22.90% 0.51% 1.02% NA
Temperate Japonica  767 73.40% 26.50% 0.13% 0.00% NA
Tropical Japonica  504 77.80% 22.00% 0.20% 0.00% NA
Japonica Intermediate  241 67.60% 32.00% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102103204 C -> A LOC_Os01g04670.1 upstream_gene_variant ; 532.0bp to feature; MODIFIER silent_mutation Average:84.144; most accessible tissue: Minghui63 root, score: 96.454 N N N N
vg0102103204 C -> A LOC_Os01g04680.1 upstream_gene_variant ; 1987.0bp to feature; MODIFIER silent_mutation Average:84.144; most accessible tissue: Minghui63 root, score: 96.454 N N N N
vg0102103204 C -> A LOC_Os01g04660.1 downstream_gene_variant ; 2510.0bp to feature; MODIFIER silent_mutation Average:84.144; most accessible tissue: Minghui63 root, score: 96.454 N N N N
vg0102103204 C -> A LOC_Os01g04660.2 downstream_gene_variant ; 2510.0bp to feature; MODIFIER silent_mutation Average:84.144; most accessible tissue: Minghui63 root, score: 96.454 N N N N
vg0102103204 C -> A LOC_Os01g04670-LOC_Os01g04680 intergenic_region ; MODIFIER silent_mutation Average:84.144; most accessible tissue: Minghui63 root, score: 96.454 N N N N
vg0102103204 C -> DEL N N silent_mutation Average:84.144; most accessible tissue: Minghui63 root, score: 96.454 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0102103204 C A -0.09 0.0 -0.01 -0.05 -0.04 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102103204 NA 4.79E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 6.72E-06 1.92E-07 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 5.89E-06 5.89E-06 mr1041_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 1.13E-06 2.39E-08 mr1184_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 1.41E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 3.87E-07 1.05E-08 mr1284_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 3.34E-07 3.34E-07 mr1286_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 4.09E-07 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 4.59E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 5.83E-06 NA mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 9.00E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 7.50E-06 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 2.42E-06 4.18E-07 mr1374_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 9.32E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 3.36E-08 3.35E-08 mr1412_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 7.21E-06 3.42E-07 mr1417_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 5.90E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 5.81E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 6.81E-06 mr1440_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 1.64E-06 mr1466_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 2.14E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 6.59E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 6.99E-06 1.08E-07 mr1494_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 2.86E-06 2.86E-06 mr1494_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 4.09E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 5.10E-06 mr1633_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 3.50E-06 3.69E-07 mr1665_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 7.28E-06 5.01E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 6.02E-07 4.63E-07 mr1687_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 6.30E-06 NA mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 4.61E-08 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 9.16E-06 4.05E-07 mr1747_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 1.07E-08 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 6.47E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 3.55E-06 1.68E-08 mr1811_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 1.74E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 2.47E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 7.43E-06 7.43E-06 mr1814_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 5.63E-06 5.55E-08 mr1816_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 7.67E-06 7.20E-08 mr1823_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 4.67E-06 4.67E-06 mr1824_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 1.57E-06 1.19E-07 mr1831_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 8.04E-06 8.04E-06 mr1831_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 4.06E-07 mr1832_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 1.51E-06 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 3.66E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 1.14E-06 mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 6.82E-07 6.82E-07 mr1847_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 7.77E-06 8.35E-08 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 3.82E-06 mr1888_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 1.08E-06 mr1894_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 1.33E-06 mr1976_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 NA 8.85E-06 mr1976_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102103204 8.54E-06 8.54E-06 mr1979_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251