\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101962916:

Variant ID: vg0101962916 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 1962916
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.03, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGCGAGAACCGTATTCTACTAGTACTCGCTTGGAGATCGGAAGTATCAGGATATACAGTGGATTTTCTATACGAACTTGATCCTAATAGTTTCAGGGA[G/T]
GGTGAACTTACCAGAAGATGTCACTGGCGGTGGCAGGTCCCATGTTATGAGGAAGCCTCCACCCACGAGCTCCACATACCTGCTGGCGTTCGCCTTGCCA

Reverse complement sequence

TGGCAAGGCGAACGCCAGCAGGTATGTGGAGCTCGTGGGTGGAGGCTTCCTCATAACATGGGACCTGCCACCGCCAGTGACATCTTCTGGTAAGTTCACC[C/A]
TCCCTGAAACTATTAGGATCAAGTTCGTATAGAAAATCCACTGTATATCCTGATACTTCCGATCTCCAAGCGAGTACTAGTAGAATACGGTTCTCGCTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.50% 24.50% 19.74% 22.24% NA
All Indica  2759 25.40% 15.90% 25.23% 33.42% NA
All Japonica  1512 53.30% 25.30% 13.76% 7.67% NA
Aus  269 5.60% 90.70% 1.86% 1.86% NA
Indica I  595 31.30% 1.80% 36.64% 30.25% NA
Indica II  465 24.90% 23.20% 22.37% 29.46% NA
Indica III  913 20.40% 21.50% 18.18% 39.98% NA
Indica Intermediate  786 27.20% 15.80% 26.46% 30.53% NA
Temperate Japonica  767 66.80% 20.50% 6.78% 6.00% NA
Tropical Japonica  504 39.70% 27.60% 20.24% 12.50% NA
Japonica Intermediate  241 39.00% 35.70% 22.41% 2.90% NA
VI/Aromatic  96 26.00% 69.80% 2.08% 2.08% NA
Intermediate  90 41.10% 27.80% 24.44% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0101962916 G -> T LOC_Os01g04409.1 intron_variant ; MODIFIER silent_mutation Average:92.585; most accessible tissue: Zhenshan97 root, score: 97.522 N N N N
vg0101962916 G -> DEL N N silent_mutation Average:92.585; most accessible tissue: Zhenshan97 root, score: 97.522 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0101962916 G T -0.01 -0.01 -0.02 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0101962916 NA 1.20E-06 mr1049_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101962916 NA 4.46E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101962916 NA 7.16E-06 mr1531_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101962916 NA 3.40E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101962916 3.21E-06 3.21E-06 mr1981_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251