Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101661898:

Variant ID: vg0101661898 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 1661898
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATTTGTTTTACGAGCCAGACGACAAGCCTATAAGCAATGGCCTCTAATGATGTTTTGTATTATGATGGAATAGCCCAGTATGTAGAAAGTCTAGATAGC[T/A]
ACATAGCAATGGCTTCTAATAATGTTTTGTTCATCATGCTTGCTCGGGAAAGCGTACGTGAGGCGCGGCGATGAGGGCCACGCCAAAATAAACATGCAGT

Reverse complement sequence

ACTGCATGTTTATTTTGGCGTGGCCCTCATCGCCGCGCCTCACGTACGCTTTCCCGAGCAAGCATGATGAACAAAACATTATTAGAAGCCATTGCTATGT[A/T]
GCTATCTAGACTTTCTACATACTGGGCTATTCCATCATAATACAAAACATCATTAGAGGCCATTGCTTATAGGCTTGTCGTCTGGCTCGTAAAACAAATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.00%	6.00%	0.00%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.00%	0.00%	NA
All Japonica	1512	82.10%	17.90%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	93.10%	6.90%	0.00%	0.00%	NA
Tropical Japonica	504	82.10%	17.90%	0.00%	0.00%	NA
Japonica Intermediate	241	47.30%	52.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0101661898	T -> A	LOC_Os01g03890.1	downstream_gene_variant ; 3510.0bp to feature; MODIFIER	silent_mutation	Average:49.965; most accessible tissue: Callus, score: 68.815	N	N	N	N
vg0101661898	T -> A	LOC_Os01g03890-LOC_Os01g03900	intergenic_region ; MODIFIER	silent_mutation	Average:49.965; most accessible tissue: Callus, score: 68.815	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0101661898	7.58E-06	NA	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101661898	3.58E-07	NA	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101661898	1.79E-06	NA	mr1023_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101661898	9.14E-06	NA	mr1079_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251