\
| Variant ID: vg0101661898 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 1661898 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TATTTGTTTTACGAGCCAGACGACAAGCCTATAAGCAATGGCCTCTAATGATGTTTTGTATTATGATGGAATAGCCCAGTATGTAGAAAGTCTAGATAGC[T/A]
ACATAGCAATGGCTTCTAATAATGTTTTGTTCATCATGCTTGCTCGGGAAAGCGTACGTGAGGCGCGGCGATGAGGGCCACGCCAAAATAAACATGCAGT
ACTGCATGTTTATTTTGGCGTGGCCCTCATCGCCGCGCCTCACGTACGCTTTCCCGAGCAAGCATGATGAACAAAACATTATTAGAAGCCATTGCTATGT[A/T]
GCTATCTAGACTTTCTACATACTGGGCTATTCCATCATAATACAAAACATCATTAGAGGCCATTGCTTATAGGCTTGTCGTCTGGCTCGTAAAACAAATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 82.10% | 17.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 82.10% | 17.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 47.30% | 52.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0101661898 | T -> A | LOC_Os01g03890.1 | downstream_gene_variant ; 3510.0bp to feature; MODIFIER | silent_mutation | Average:49.965; most accessible tissue: Callus, score: 68.815 | N | N | N | N |
| vg0101661898 | T -> A | LOC_Os01g03890-LOC_Os01g03900 | intergenic_region ; MODIFIER | silent_mutation | Average:49.965; most accessible tissue: Callus, score: 68.815 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0101661898 | 7.58E-06 | NA | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101661898 | 3.58E-07 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101661898 | 1.79E-06 | NA | mr1023_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101661898 | 9.14E-06 | NA | mr1079_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |