Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101656901:

Variant ID: vg0101656901 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 1656901
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AGCATATTGCAACAGCTATAGCAGTACTACTACTATAGCTTGAATGGAGTAAACATATGACTTCTTTTTTTTCCTCCTAATACCGGGTTTCTAATTAGTC[A/G]
GAACCTTCTGTCAGATCCCTTTCTTTTTGAGGCAAGTACACAATATATATTCAACTCCCATATATATATATTAATTATAACCAAGTTAATTCAACCTAGG

Reverse complement sequence

CCTAGGTTGAATTAACTTGGTTATAATTAATATATATATATGGGAGTTGAATATATATTGTGTACTTGCCTCAAAAAGAAAGGGATCTGACAGAAGGTTC[T/C]
GACTAATTAGAAACCCGGTATTAGGAGGAAAAAAAAGAAGTCATATGTTTACTCCATTCAAGCTATAGTAGTAGTACTGCTATAGCTGTTGCAATATGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.90% 45.00% 0.17% 0.00% NA
All Indica  2759 59.60% 40.40% 0.04% 0.00% NA
All Japonica  1512 53.80% 46.00% 0.13% 0.00% NA
Aus  269 9.30% 89.60% 1.12% 0.00% NA
Indica I  595 80.80% 19.20% 0.00% 0.00% NA
Indica II  465 12.90% 86.90% 0.22% 0.00% NA
Indica III  913 70.80% 29.20% 0.00% 0.00% NA
Indica Intermediate  786 58.10% 41.90% 0.00% 0.00% NA
Temperate Japonica  767 90.70% 9.30% 0.00% 0.00% NA
Tropical Japonica  504 5.80% 93.80% 0.40% 0.00% NA
Japonica Intermediate  241 36.90% 63.10% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 37.80% 60.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0101656901 A -> G LOC_Os01g03890.1 upstream_gene_variant ; 414.0bp to feature; MODIFIER silent_mutation Average:54.024; most accessible tissue: Minghui63 root, score: 91.181 N N N N
vg0101656901 A -> G LOC_Os01g03880-LOC_Os01g03890 intergenic_region ; MODIFIER silent_mutation Average:54.024; most accessible tissue: Minghui63 root, score: 91.181 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0101656901 A G 0.11 0.05 0.02 0.01 0.04 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0101656901 NA 2.36E-07 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 1.12E-06 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 1.18E-08 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 4.78E-13 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 1.37E-06 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 3.25E-07 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 6.07E-07 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 9.07E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 4.03E-07 mr1043_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 9.31E-06 mr1185_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 6.54E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 7.86E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 3.92E-08 mr1291_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 1.80E-11 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 1.92E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 7.80E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 2.75E-14 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 9.29E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 6.57E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 6.32E-14 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 1.41E-07 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 1.01E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 5.72E-07 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 3.92E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 9.31E-09 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 3.27E-10 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 6.20E-06 mr1887_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101656901 NA 9.81E-08 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251