\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101639685:

Variant ID: vg0101639685 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 1639685
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 363. )

Flanking Sequence (100 bp) in Reference Genome:


GAATCGGCCCAACGACCAAGGGGGAGGCAAAATAGACTTTTGCAGAGAGATGATTTGGAAGGGATTTGGATTTGGAATTGAATTTCGAATTTGATTACTT[G/T]
GACTCAGGGAAACAGGGAGGAGTCAAGGAATGGATTCAAGGTGGACTCGGATATTTGTGGAATCGGGACAAGTATTTGGCGAGGATTCAAAGGAGGCGAT

Reverse complement sequence

ATCGCCTCCTTTGAATCCTCGCCAAATACTTGTCCCGATTCCACAAATATCCGAGTCCACCTTGAATCCATTCCTTGACTCCTCCCTGTTTCCCTGAGTC[C/A]
AAGTAATCAAATTCGAAATTCAATTCCAAATCCAAATCCCTTCCAAATCATCTCTCTGCAAAAGTCTATTTTGCCTCCCCCTTGGTCGTTGGGCCGATTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.80% 6.20% 0.02% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 81.40% 18.50% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 93.40% 6.50% 0.13% 0.00% NA
Tropical Japonica  504 80.20% 19.80% 0.00% 0.00% NA
Japonica Intermediate  241 46.10% 53.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0101639685 G -> T LOC_Os01g03860.1 downstream_gene_variant ; 649.0bp to feature; MODIFIER silent_mutation Average:50.264; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0101639685 G -> T LOC_Os01g03870.1 downstream_gene_variant ; 1549.0bp to feature; MODIFIER silent_mutation Average:50.264; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0101639685 G -> T LOC_Os01g03860-LOC_Os01g03870 intergenic_region ; MODIFIER silent_mutation Average:50.264; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0101639685 3.96E-06 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639685 2.85E-07 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639685 3.96E-06 NA mr1079_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639685 5.83E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639685 1.59E-06 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639685 NA 1.24E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639685 7.00E-06 NA mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251