Variant ID: vg0101639685 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 1639685 |
Reference Allele: G | Alternative Allele: T |
Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 363. )
GAATCGGCCCAACGACCAAGGGGGAGGCAAAATAGACTTTTGCAGAGAGATGATTTGGAAGGGATTTGGATTTGGAATTGAATTTCGAATTTGATTACTT[G/T]
GACTCAGGGAAACAGGGAGGAGTCAAGGAATGGATTCAAGGTGGACTCGGATATTTGTGGAATCGGGACAAGTATTTGGCGAGGATTCAAAGGAGGCGAT
ATCGCCTCCTTTGAATCCTCGCCAAATACTTGTCCCGATTCCACAAATATCCGAGTCCACCTTGAATCCATTCCTTGACTCCTCCCTGTTTCCCTGAGTC[C/A]
AAGTAATCAAATTCGAAATTCAATTCCAAATCCAAATCCCTTCCAAATCATCTCTCTGCAAAAGTCTATTTTGCCTCCCCCTTGGTCGTTGGGCCGATTC
Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 93.80% | 6.20% | 0.02% | 0.00% | NA |
All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 81.40% | 18.50% | 0.07% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 93.40% | 6.50% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 46.10% | 53.90% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0101639685 | G -> T | LOC_Os01g03860.1 | downstream_gene_variant ; 649.0bp to feature; MODIFIER | silent_mutation | Average:50.264; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
vg0101639685 | G -> T | LOC_Os01g03870.1 | downstream_gene_variant ; 1549.0bp to feature; MODIFIER | silent_mutation | Average:50.264; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
vg0101639685 | G -> T | LOC_Os01g03860-LOC_Os01g03870 | intergenic_region ; MODIFIER | silent_mutation | Average:50.264; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0101639685 | 3.96E-06 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0101639685 | 2.85E-07 | NA | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0101639685 | 3.96E-06 | NA | mr1079_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0101639685 | 5.83E-06 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0101639685 | 1.59E-06 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0101639685 | NA | 1.24E-10 | mr1646_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0101639685 | 7.00E-06 | NA | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |