Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101356395:

Variant ID: vg0101356395 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 1356395
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCAAATTATGGGTTTATATTTCCAACATCAATGGCACCATAGCACTTCACAGTGGAGGAAGAACAGGAAAAATTAGAAATTAATCTAATTACTGCATTC[C/T]
GAGTTGTAAAAATAATGTGAATAATGTGCATTTATTTGCATTTCATTCTAAAACCTAGAAAAAGTAGTAAAGAAATCGAATGTCTGGAATTTGTGTATTT

Reverse complement sequence

AAATACACAAATTCCAGACATTCGATTTCTTTACTACTTTTTCTAGGTTTTAGAATGAAATGCAAATAAATGCACATTATTCACATTATTTTTACAACTC[G/A]
GAATGCAGTAATTAGATTAATTTCTAATTTTTCCTGTTCTTCCTCCACTGTGAAGTGCTATGGTGCCATTGATGTTGGAAATATAAACCCATAATTTGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.50%	8.50%	0.04%	0.00%	NA
All Indica	2759	95.40%	4.60%	0.00%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	10.80%	88.50%	0.74%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	93.10%	6.90%	0.00%	0.00%	NA
Indica Intermediate	786	92.10%	7.90%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	80.20%	19.80%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0101356395	C -> T	LOC_Os01g03360.1	upstream_gene_variant ; 1593.0bp to feature; MODIFIER	silent_mutation	Average:42.366; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0101356395	C -> T	LOC_Os01g03370.1	downstream_gene_variant ; 206.0bp to feature; MODIFIER	silent_mutation	Average:42.366; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0101356395	C -> T	LOC_Os01g03360-LOC_Os01g03370	intergenic_region ; MODIFIER	silent_mutation	Average:42.366; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0101356395	NA	5.65E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101356395	NA	1.03E-10	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101356395	NA	2.06E-09	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101356395	NA	1.59E-20	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101356395	4.41E-06	NA	mr1529_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101356395	NA	1.93E-15	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101356395	NA	2.27E-09	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101356395	NA	1.73E-17	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101356395	NA	1.05E-13	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101356395	NA	5.71E-15	mr1961_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251