| Variant ID: vg0101352726 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 1352726 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTCATAGCTTGCAGAAAACAAACCAATCCAATCCACTCACAGAGCACCCAAACCAATCCAAACCAAGTGTAGAAAAATGGATTCAACCCATTCCCAACCC[A/C]
AAGGAAATCCACAATACTCGTCCTTCCTCCTTCACTAGTTCAGAGATAAGCAACTTAGTCAGACATACCCTGAACAACAAGCTTAAAAGATTCGTTTCGC
GCGAAACGAATCTTTTAAGCTTGTTGTTCAGGGTATGTCTGACTAAGTTGCTTATCTCTGAACTAGTGAAGGAGGAAGGACGAGTATTGTGGATTTCCTT[T/G]
GGGTTGGGAATGGGTTGAATCCATTTTTCTACACTTGGTTTGGATTGGTTTGGGTGCTCTGTGAGTGGATTGGATTGGTTTGTTTTCTGCAAGCTATGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.70% | 1.10% | 1.86% | 1.27% | NA |
| All Indica | 2759 | 96.40% | 0.20% | 1.38% | 2.07% | NA |
| All Japonica | 1512 | 93.60% | 3.20% | 3.24% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.30% | 0.00% | 2.69% | 1.01% | NA |
| Indica II | 465 | 97.80% | 0.00% | 1.94% | 0.22% | NA |
| Indica III | 913 | 96.10% | 0.00% | 0.22% | 3.72% | NA |
| Indica Intermediate | 786 | 95.90% | 0.60% | 1.40% | 2.04% | NA |
| Temperate Japonica | 767 | 89.70% | 5.70% | 4.56% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 0.00% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 1.70% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0101352726 | A -> DEL | N | N | silent_mutation | Average:69.024; most accessible tissue: Zhenshan97 flower, score: 89.987 | N | N | N | N |
| vg0101352726 | A -> C | LOC_Os01g03340.1 | upstream_gene_variant ; 3940.0bp to feature; MODIFIER | silent_mutation | Average:69.024; most accessible tissue: Zhenshan97 flower, score: 89.987 | N | N | N | N |
| vg0101352726 | A -> C | LOC_Os01g03350.1 | downstream_gene_variant ; 1619.0bp to feature; MODIFIER | silent_mutation | Average:69.024; most accessible tissue: Zhenshan97 flower, score: 89.987 | N | N | N | N |
| vg0101352726 | A -> C | LOC_Os01g03360.1 | downstream_gene_variant ; 903.0bp to feature; MODIFIER | silent_mutation | Average:69.024; most accessible tissue: Zhenshan97 flower, score: 89.987 | N | N | N | N |
| vg0101352726 | A -> C | LOC_Os01g03370.1 | downstream_gene_variant ; 3875.0bp to feature; MODIFIER | silent_mutation | Average:69.024; most accessible tissue: Zhenshan97 flower, score: 89.987 | N | N | N | N |
| vg0101352726 | A -> C | LOC_Os01g03350-LOC_Os01g03360 | intergenic_region ; MODIFIER | silent_mutation | Average:69.024; most accessible tissue: Zhenshan97 flower, score: 89.987 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0101352726 | 8.73E-07 | NA | mr1100 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101352726 | 5.47E-06 | 5.47E-06 | mr1193 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101352726 | NA | 3.25E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101352726 | 9.71E-07 | 9.71E-07 | mr1855 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |