\
| Variant ID: vg0101350174 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 1350174 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTTCGATATACGTTACATATCGATATGGCATACCCACGCGCACGCGGATGTTTTCTACATATCCTAAGGAAACCTTTCACGAAATCTACAGATGGGAAGA[G/A]
TCCTTCTCGGATAGAACTGGATCGTCGACGTATCGTATTGGGTCTGATATCTCCGAGTCCTACTTGGAGACCTCCAGATCTGTGATATAACAGGGACCCC
GGGGTCCCTGTTATATCACAGATCTGGAGGTCTCCAAGTAGGACTCGGAGATATCAGACCCAATACGATACGTCGACGATCCAGTTCTATCCGAGAAGGA[C/T]
TCTTCCCATCTGTAGATTTCGTGAAAGGTTTCCTTAGGATATGTAGAAAACATCCGCGTGCGCGTGGGTATGCCATATCGATATGTAACGTATATCGAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.20% | 0.10% | 0.38% | 18.28% | NA |
| All Indica | 2759 | 71.30% | 0.10% | 0.54% | 28.02% | NA |
| All Japonica | 1512 | 94.40% | 0.10% | 0.20% | 5.29% | NA |
| Aus | 269 | 98.90% | 0.40% | 0.00% | 0.74% | NA |
| Indica I | 595 | 73.60% | 0.20% | 0.84% | 25.38% | NA |
| Indica II | 465 | 95.10% | 0.00% | 0.65% | 4.30% | NA |
| Indica III | 913 | 56.50% | 0.10% | 0.22% | 43.15% | NA |
| Indica Intermediate | 786 | 72.60% | 0.30% | 0.64% | 26.46% | NA |
| Temperate Japonica | 767 | 89.30% | 0.10% | 0.39% | 10.17% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 93.30% | 1.10% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0101350174 | G -> A | LOC_Os01g03330.1 | upstream_gene_variant ; 3755.0bp to feature; MODIFIER | silent_mutation | Average:64.861; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0101350174 | G -> A | LOC_Os01g03340.1 | upstream_gene_variant ; 1388.0bp to feature; MODIFIER | silent_mutation | Average:64.861; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0101350174 | G -> A | LOC_Os01g03350.1 | upstream_gene_variant ; 646.0bp to feature; MODIFIER | silent_mutation | Average:64.861; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0101350174 | G -> A | LOC_Os01g03360.1 | downstream_gene_variant ; 3455.0bp to feature; MODIFIER | silent_mutation | Average:64.861; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0101350174 | G -> A | LOC_Os01g03340-LOC_Os01g03350 | intergenic_region ; MODIFIER | silent_mutation | Average:64.861; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0101350174 | G -> DEL | N | N | silent_mutation | Average:64.861; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0101350174 | NA | 5.54E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101350174 | NA | 7.98E-06 | mr1189 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101350174 | NA | 2.40E-06 | mr1291 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101350174 | NA | 4.68E-06 | mr1324 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101350174 | NA | 3.60E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101350174 | NA | 5.00E-06 | mr1625 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101350174 | NA | 4.55E-06 | mr1678 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101350174 | NA | 4.86E-09 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101350174 | NA | 6.36E-06 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101350174 | NA | 1.28E-09 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101350174 | NA | 4.09E-07 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101350174 | 2.31E-06 | 3.74E-07 | mr1768 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |