\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101344528:

Variant ID: vg0101344528 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 1344528
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


ATATATATAGATTTATCTTTCAAAGTACTATAATAAAAATAAACATGCATTTATTTATTATATATATTATAATAGAAAAATAAGGTTAAAGATATATTTT[G/A]
TAGACCATGTTATTGTCCAAAACGTCAATTAAAATGAAATAGGAGAGAGTAGTATTTATGAATTATGAGGACAACTCAACATGCATATAGATCACACGAG

Reverse complement sequence

CTCGTGTGATCTATATGCATGTTGAGTTGTCCTCATAATTCATAAATACTACTCTCTCCTATTTCATTTTAATTGACGTTTTGGACAATAACATGGTCTA[C/T]
AAAATATATCTTTAACCTTATTTTTCTATTATAATATATATAATAAATAAATGCATGTTTATTTTTATTATAGTACTTTGAAAGATAAATCTATATATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.80% 10.10% 1.76% 18.35% NA
All Indica  2759 63.80% 7.00% 2.50% 26.71% NA
All Japonica  1512 90.50% 0.90% 0.60% 8.00% NA
Aus  269 9.70% 88.50% 0.74% 1.12% NA
Indica I  595 68.70% 1.20% 4.54% 25.55% NA
Indica II  465 94.00% 0.40% 0.86% 4.73% NA
Indica III  913 47.30% 11.30% 1.42% 39.98% NA
Indica Intermediate  786 61.50% 10.20% 3.18% 25.19% NA
Temperate Japonica  767 87.50% 0.10% 0.91% 11.47% NA
Tropical Japonica  504 97.00% 2.40% 0.00% 0.60% NA
Japonica Intermediate  241 86.30% 0.40% 0.83% 12.45% NA
VI/Aromatic  96 75.00% 21.90% 2.08% 1.04% NA
Intermediate  90 77.80% 15.60% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0101344528 G -> A LOC_Os01g03320.1 upstream_gene_variant ; 2251.0bp to feature; MODIFIER silent_mutation Average:74.346; most accessible tissue: Callus, score: 93.949 N N N N
vg0101344528 G -> A LOC_Os01g03330.1 downstream_gene_variant ; 29.0bp to feature; MODIFIER silent_mutation Average:74.346; most accessible tissue: Callus, score: 93.949 N N N N
vg0101344528 G -> A LOC_Os01g03340.1 downstream_gene_variant ; 3039.0bp to feature; MODIFIER silent_mutation Average:74.346; most accessible tissue: Callus, score: 93.949 N N N N
vg0101344528 G -> A LOC_Os01g03320-LOC_Os01g03330 intergenic_region ; MODIFIER silent_mutation Average:74.346; most accessible tissue: Callus, score: 93.949 N N N N
vg0101344528 G -> DEL N N silent_mutation Average:74.346; most accessible tissue: Callus, score: 93.949 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0101344528 G A 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0101344528 NA 6.61E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528 NA 1.08E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528 NA 5.75E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528 NA 4.86E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528 NA 4.24E-17 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528 NA 2.31E-22 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528 NA 1.44E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528 NA 3.34E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528 4.65E-06 NA mr1497_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528 NA 9.12E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528 NA 9.45E-08 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528 NA 1.30E-16 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528 NA 1.00E-06 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528 NA 2.48E-13 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528 NA 6.45E-17 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251