Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101344528:

Variant ID: vg0101344528 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 1344528
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

ATATATATAGATTTATCTTTCAAAGTACTATAATAAAAATAAACATGCATTTATTTATTATATATATTATAATAGAAAAATAAGGTTAAAGATATATTTT[G/A]
TAGACCATGTTATTGTCCAAAACGTCAATTAAAATGAAATAGGAGAGAGTAGTATTTATGAATTATGAGGACAACTCAACATGCATATAGATCACACGAG

Reverse complement sequence

CTCGTGTGATCTATATGCATGTTGAGTTGTCCTCATAATTCATAAATACTACTCTCTCCTATTTCATTTTAATTGACGTTTTGGACAATAACATGGTCTA[C/T]
AAAATATATCTTTAACCTTATTTTTCTATTATAATATATATAATAAATAAATGCATGTTTATTTTTATTATAGTACTTTGAAAGATAAATCTATATATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.80%	10.10%	1.76%	18.35%	NA
All Indica	2759	63.80%	7.00%	2.50%	26.71%	NA
All Japonica	1512	90.50%	0.90%	0.60%	8.00%	NA
Aus	269	9.70%	88.50%	0.74%	1.12%	NA
Indica I	595	68.70%	1.20%	4.54%	25.55%	NA
Indica II	465	94.00%	0.40%	0.86%	4.73%	NA
Indica III	913	47.30%	11.30%	1.42%	39.98%	NA
Indica Intermediate	786	61.50%	10.20%	3.18%	25.19%	NA
Temperate Japonica	767	87.50%	0.10%	0.91%	11.47%	NA
Tropical Japonica	504	97.00%	2.40%	0.00%	0.60%	NA
Japonica Intermediate	241	86.30%	0.40%	0.83%	12.45%	NA
VI/Aromatic	96	75.00%	21.90%	2.08%	1.04%	NA
Intermediate	90	77.80%	15.60%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0101344528	G -> A	LOC_Os01g03320.1	upstream_gene_variant ; 2251.0bp to feature; MODIFIER	silent_mutation	Average:74.346; most accessible tissue: Callus, score: 93.949	N	N	N	N
vg0101344528	G -> A	LOC_Os01g03330.1	downstream_gene_variant ; 29.0bp to feature; MODIFIER	silent_mutation	Average:74.346; most accessible tissue: Callus, score: 93.949	N	N	N	N
vg0101344528	G -> A	LOC_Os01g03340.1	downstream_gene_variant ; 3039.0bp to feature; MODIFIER	silent_mutation	Average:74.346; most accessible tissue: Callus, score: 93.949	N	N	N	N
vg0101344528	G -> A	LOC_Os01g03320-LOC_Os01g03330	intergenic_region ; MODIFIER	silent_mutation	Average:74.346; most accessible tissue: Callus, score: 93.949	N	N	N	N
vg0101344528	G -> DEL	N	N	silent_mutation	Average:74.346; most accessible tissue: Callus, score: 93.949	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0101344528	G	A	0.0	0.0	0.0	0.0	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0101344528	NA	6.61E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528	NA	1.08E-11	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528	NA	5.75E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528	NA	4.86E-07	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528	NA	4.24E-17	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528	NA	2.31E-22	mr1247_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528	NA	1.44E-06	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528	NA	3.34E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528	4.65E-06	NA	mr1497_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528	NA	9.12E-15	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528	NA	9.45E-08	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528	NA	1.30E-16	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528	NA	1.00E-06	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528	NA	2.48E-13	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101344528	NA	6.45E-17	mr1961_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251