\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101302139:

Variant ID: vg0101302139 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 1302139
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCATCATCATTTGCTTGAGGTTTGACGGGATTGATGAATGAATGATCATTGTTTTGGGCAAGAAACATACTCCGATAAACAAGATCGATCACATCACAT[C/A]
TGTTTGGACCTGTTGGGTAAGTTTTGCATGTTACCCAAATTGTTAGTACCAAAAGATTAATCTGTCATTTAAAATTTTTGAAATTTTTCACAAACTGTTT

Reverse complement sequence

AAACAGTTTGTGAAAAATTTCAAAAATTTTAAATGACAGATTAATCTTTTGGTACTAACAATTTGGGTAACATGCAAAACTTACCCAACAGGTCCAAACA[G/T]
ATGTGATGTGATCGATCTTGTTTATCGGAGTATGTTTCTTGCCCAAAACAATGATCATTCATTCATCAATCCCGTCAAACCTCAAGCAAATGATGATGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.90% 19.80% 0.17% 0.06% NA
All Indica  2759 70.50% 29.20% 0.22% 0.11% NA
All Japonica  1512 92.10% 7.90% 0.07% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 73.60% 25.70% 0.50% 0.17% NA
Indica II  465 95.10% 4.90% 0.00% 0.00% NA
Indica III  913 55.10% 44.60% 0.22% 0.11% NA
Indica Intermediate  786 71.40% 28.40% 0.13% 0.13% NA
Temperate Japonica  767 85.80% 14.10% 0.13% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0101302139 C -> A LOC_Os01g03220.1 intron_variant ; MODIFIER silent_mutation Average:36.961; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg0101302139 C -> DEL N N silent_mutation Average:36.961; most accessible tissue: Minghui63 root, score: 54.099 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0101302139 NA 3.40E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101302139 NA 7.22E-06 mr1192 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101302139 NA 3.03E-07 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101302139 NA 9.68E-09 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101302139 NA 6.03E-09 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101302139 NA 3.67E-06 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101302139 NA 2.61E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101302139 NA 9.17E-06 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251