\
| Variant ID: vg0101302139 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 1302139 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATCATCATCATTTGCTTGAGGTTTGACGGGATTGATGAATGAATGATCATTGTTTTGGGCAAGAAACATACTCCGATAAACAAGATCGATCACATCACAT[C/A]
TGTTTGGACCTGTTGGGTAAGTTTTGCATGTTACCCAAATTGTTAGTACCAAAAGATTAATCTGTCATTTAAAATTTTTGAAATTTTTCACAAACTGTTT
AAACAGTTTGTGAAAAATTTCAAAAATTTTAAATGACAGATTAATCTTTTGGTACTAACAATTTGGGTAACATGCAAAACTTACCCAACAGGTCCAAACA[G/T]
ATGTGATGTGATCGATCTTGTTTATCGGAGTATGTTTCTTGCCCAAAACAATGATCATTCATTCATCAATCCCGTCAAACCTCAAGCAAATGATGATGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.90% | 19.80% | 0.17% | 0.06% | NA |
| All Indica | 2759 | 70.50% | 29.20% | 0.22% | 0.11% | NA |
| All Japonica | 1512 | 92.10% | 7.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 73.60% | 25.70% | 0.50% | 0.17% | NA |
| Indica II | 465 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 55.10% | 44.60% | 0.22% | 0.11% | NA |
| Indica Intermediate | 786 | 71.40% | 28.40% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 85.80% | 14.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0101302139 | C -> A | LOC_Os01g03220.1 | intron_variant ; MODIFIER | silent_mutation | Average:36.961; most accessible tissue: Minghui63 root, score: 54.099 | N | N | N | N |
| vg0101302139 | C -> DEL | N | N | silent_mutation | Average:36.961; most accessible tissue: Minghui63 root, score: 54.099 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0101302139 | NA | 3.40E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101302139 | NA | 7.22E-06 | mr1192 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101302139 | NA | 3.03E-07 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101302139 | NA | 9.68E-09 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101302139 | NA | 6.03E-09 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101302139 | NA | 3.67E-06 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101302139 | NA | 2.61E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101302139 | NA | 9.17E-06 | mr1954_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |