RiceVarMap2

Detailed information for vg0101299481:

Variant ID: vg0101299481 (JBrowse)

Variation Type: SNP

Chromosome: chr01

Position: 1299481

Reference Allele: C

Alternative Allele: G

Primary Allele: C

Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATCAAGATCTAAAACTTTTATTTTTGTTATTTCTTCATCCGATGAAATGTTAGTAATATTATTCACAAATTTTACATATATGTGTTATAATTTATAAAC[C/G]
AGATAAGATATATGTCAATTTTGTAAACAATGCTACTATCACTTTCTCGTATGAAGAAATGACCAAAATAAAAGTTTTAGATCTTGATGAGTTATTCAAC

Reverse complement sequence

GTTGAATAACTCATCAAGATCTAAAACTTTTATTTTGGTCATTTCTTCATACGAGAAAGTGATAGTAGCATTGTTTACAAAATTGACATATATCTTATCT[G/C]
GTTTATAAATTATAACACATATATGTAAAATTTGTGAATAATATTACTAACATTTCATCGGATGAAGAAATAACAAAAATAAAAGTTTTAGATCTTGATG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.10%	2.80%	3.20%	16.86%	NA
All Indica	2759	71.40%	0.10%	3.01%	25.52%	NA
All Japonica	1512	81.30%	8.50%	4.37%	5.82%	NA
Aus	269	99.30%	0.40%	0.00%	0.37%	NA
Indica I	595	71.60%	0.00%	6.05%	22.35%	NA
Indica II	465	94.80%	0.00%	0.86%	4.30%	NA
Indica III	913	57.30%	0.10%	2.19%	40.42%	NA
Indica Intermediate	786	73.80%	0.10%	2.93%	23.16%	NA
Temperate Japonica	767	82.50%	1.80%	4.43%	11.21%	NA
Tropical Japonica	504	93.10%	5.60%	0.99%	0.40%	NA
Japonica Intermediate	241	53.10%	35.70%	11.20%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	91.10%	3.30%	2.22%	3.33%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0101299481	C -> G	LOC_Os01g03220.1	upstream_gene_variant ; 2046.0bp to feature; MODIFIER	silent_mutation	Average:16.545; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0101299481	C -> G	LOC_Os01g03210-LOC_Os01g03220	intergenic_region ; MODIFIER	silent_mutation	Average:16.545; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0101299481	C -> DEL	N	N	silent_mutation	Average:16.545; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0101299481	2.98E-06	NA	mr1602	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0101299481:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact