\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101207412:

Variant ID: vg0101207412 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 1207412
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGATGGATCTCGAGGAGTAATGCTCCTTATGATCTCATGCATGGACTGCCTGATGCTTTGGGGTGAATAACGCTAAAATTGAAAGTTTGGTTAAAATTG[G/A]
AACGATATGACAGAAAAATTGAAAGTTTATATGTGTAGAAAAGTTTTGATGTGATGAAAAAATTAAAAGTTTAAATAAAAAGTTTAGAACTAAACCAGAC

Reverse complement sequence

GTCTGGTTTAGTTCTAAACTTTTTATTTAAACTTTTAATTTTTTCATCACATCAAAACTTTTCTACACATATAAACTTTCAATTTTTCTGTCATATCGTT[C/T]
CAATTTTAACCAAACTTTCAATTTTAGCGTTATTCACCCCAAAGCATCAGGCAGTCCATGCATGAGATCATAAGGAGCATTACTCCTCGAGATCCATCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 13.70% 0.68% 0.00% NA
All Indica  2759 87.80% 11.30% 0.83% 0.00% NA
All Japonica  1512 95.80% 3.70% 0.53% 0.00% NA
Aus  269 9.30% 90.70% 0.00% 0.00% NA
Indica I  595 99.20% 0.30% 0.50% 0.00% NA
Indica II  465 98.30% 0.60% 1.08% 0.00% NA
Indica III  913 75.70% 24.20% 0.11% 0.00% NA
Indica Intermediate  786 87.20% 11.10% 1.78% 0.00% NA
Temperate Japonica  767 99.60% 0.10% 0.26% 0.00% NA
Tropical Japonica  504 89.90% 9.90% 0.20% 0.00% NA
Japonica Intermediate  241 95.90% 2.10% 2.07% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0101207412 G -> A LOC_Os01g03110.1 upstream_gene_variant ; 3906.0bp to feature; MODIFIER silent_mutation Average:81.486; most accessible tissue: Minghui63 panicle, score: 97.557 N N N N
vg0101207412 G -> A LOC_Os01g03110-LOC_Os01g03130 intergenic_region ; MODIFIER silent_mutation Average:81.486; most accessible tissue: Minghui63 panicle, score: 97.557 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0101207412 G A -0.02 -0.01 -0.01 0.03 0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0101207412 NA 6.24E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101207412 NA 1.62E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101207412 NA 2.03E-06 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101207412 NA 7.34E-07 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101207412 NA 7.86E-16 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101207412 NA 5.27E-11 mr1582_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101207412 NA 8.36E-17 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101207412 NA 1.23E-06 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101207412 NA 2.52E-14 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101207412 NA 1.30E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101207412 NA 1.72E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251