Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101173938:

Variant ID: vg0101173938 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 1173938
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


GTCACCTGCATGGTGTTGCTTGCTGAGCTCAATCTCTCTCTACAAGAAGAGATTAATAGTGATTTTTGTGAGCTTAAGTAATCATATGCTATTGTAATGT[G/A]
ACAATCAAGGAATTGTGAGAAACAAACCAGCTGCTCTTGCTCATGAAGGATTTTCTCTACTTCAAGGCGTTTTTGAAAAGCTTGCTCAATTAGAGGTGCC

Reverse complement sequence

GGCACCTCTAATTGAGCAAGCTTTTCAAAAACGCCTTGAAGTAGAGAAAATCCTTCATGAGCAAGAGCAGCTGGTTTGTTTCTCACAATTCCTTGATTGT[C/T]
ACATTACAATAGCATATGATTACTTAAGCTCACAAAAATCACTATTAATCTCTTCTTGTAGAGAGAGATTGAGCTCAGCAAGCAACACCATGCAGGTGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.90% 27.90% 0.00% 0.21% NA
All Indica  2759 65.70% 34.00% 0.00% 0.25% NA
All Japonica  1512 94.90% 5.10% 0.00% 0.00% NA
Aus  269 6.30% 93.70% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 28.40% 71.00% 0.00% 0.65% NA
Indica III  913 66.40% 33.50% 0.00% 0.11% NA
Indica Intermediate  786 62.00% 37.70% 0.00% 0.38% NA
Temperate Japonica  767 96.60% 3.40% 0.00% 0.00% NA
Tropical Japonica  504 91.30% 8.70% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 62.20% 34.40% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0101173938 G -> A LOC_Os01g03060.1 upstream_gene_variant ; 2812.0bp to feature; MODIFIER silent_mutation Average:56.013; most accessible tissue: Callus, score: 81.296 N N N N
vg0101173938 G -> A LOC_Os01g03060.2 upstream_gene_variant ; 2810.0bp to feature; MODIFIER silent_mutation Average:56.013; most accessible tissue: Callus, score: 81.296 N N N N
vg0101173938 G -> A LOC_Os01g03060.3 upstream_gene_variant ; 2808.0bp to feature; MODIFIER silent_mutation Average:56.013; most accessible tissue: Callus, score: 81.296 N N N N
vg0101173938 G -> A LOC_Os01g03070.1 intron_variant ; MODIFIER silent_mutation Average:56.013; most accessible tissue: Callus, score: 81.296 N N N N
vg0101173938 G -> A LOC_Os01g03070.2 intron_variant ; MODIFIER silent_mutation Average:56.013; most accessible tissue: Callus, score: 81.296 N N N N
vg0101173938 G -> DEL N N silent_mutation Average:56.013; most accessible tissue: Callus, score: 81.296 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0101173938 NA 1.35E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 2.52E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 7.08E-07 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 1.51E-08 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 8.22E-12 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 1.08E-10 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 2.94E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 2.46E-12 mr1291 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 9.77E-07 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 1.89E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 5.13E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 4.39E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 3.87E-10 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 8.36E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 1.94E-08 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 1.39E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 3.81E-08 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 5.77E-11 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 8.83E-08 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 8.05E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 4.44E-11 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 4.56E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 1.69E-10 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 4.82E-08 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 3.23E-06 mr1731 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 1.53E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 2.29E-07 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 1.28E-07 mr1919 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 2.52E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 4.31E-11 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 7.84E-07 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 7.61E-13 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 5.27E-07 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 5.73E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 4.37E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 3.38E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 1.08E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 7.93E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 1.40E-10 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 3.30E-07 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101173938 NA 5.92E-07 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251