\
| Variant ID: vg0101141375 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 1141375 |
| Reference Allele: GT | Alternative Allele: G,AT |
| Primary Allele: GT | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TACGTGTTTGATTTTAGAAATGATATCACATGTTTTCCATGCGAGAGTTGAGAGAGAGAGAGAGAGTTATCAGAATTTGAGTATATCCATATGCAATAGT[GT/G,AT]
TTTTTTATCCGTTCTATGAGTATATCAATCATGCGCTAATATCTTTCTTTCTTTGTGCGTGTTAATTTTATCTTCATCTTCATTAAAAAAACACCAACTT
AAGTTGGTGTTTTTTTAATGAAGATGAAGATAAAATTAACACGCACAAAGAAAGAAAGATATTAGCGCATGATTGATATACTCATAGAACGGATAAAAAA[AC/C,AT]
ACTATTGCATATGGATATACTCAAATTCTGATAACTCTCTCTCTCTCTCTCAACTCTCGCATGGAAAACATGTGATATCATTTCTAAAATCAAACACGTA
| Populations | Population Size | Frequency of GT(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.90% | 40.50% | 0.80% | 0.00% | AT: 1.86% |
| All Indica | 2759 | 46.80% | 52.90% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 82.90% | 9.50% | 1.79% | 0.00% | AT: 5.82% |
| Aus | 269 | 6.70% | 93.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 34.60% | 65.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 25.20% | 74.20% | 0.65% | 0.00% | NA |
| Indica III | 913 | 67.40% | 32.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 45.00% | 54.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 81.90% | 3.90% | 3.00% | 0.00% | AT: 11.21% |
| Tropical Japonica | 504 | 79.40% | 20.00% | 0.40% | 0.00% | AT: 0.20% |
| Japonica Intermediate | 241 | 93.40% | 5.40% | 0.83% | 0.00% | AT: 0.41% |
| VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 41.10% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0101141375 | GT -> G | LOC_Os01g02990.1 | upstream_gene_variant ; 3752.0bp to feature; MODIFIER | silent_mutation | Average:40.61; most accessible tissue: Callus, score: 57.985 | N | N | N | N |
| vg0101141375 | GT -> G | LOC_Os01g03010.1 | downstream_gene_variant ; 2181.0bp to feature; MODIFIER | silent_mutation | Average:40.61; most accessible tissue: Callus, score: 57.985 | N | N | N | N |
| vg0101141375 | GT -> G | LOC_Os01g03020.1 | downstream_gene_variant ; 4453.0bp to feature; MODIFIER | silent_mutation | Average:40.61; most accessible tissue: Callus, score: 57.985 | N | N | N | N |
| vg0101141375 | GT -> G | LOC_Os01g02990-LOC_Os01g03010 | intergenic_region ; MODIFIER | silent_mutation | Average:40.61; most accessible tissue: Callus, score: 57.985 | N | N | N | N |
| vg0101141375 | GT -> AT | LOC_Os01g02990.1 | upstream_gene_variant ; 3751.0bp to feature; MODIFIER | silent_mutation | Average:40.61; most accessible tissue: Callus, score: 57.985 | N | N | N | N |
| vg0101141375 | GT -> AT | LOC_Os01g03010.1 | downstream_gene_variant ; 2182.0bp to feature; MODIFIER | silent_mutation | Average:40.61; most accessible tissue: Callus, score: 57.985 | N | N | N | N |
| vg0101141375 | GT -> AT | LOC_Os01g03020.1 | downstream_gene_variant ; 4454.0bp to feature; MODIFIER | silent_mutation | Average:40.61; most accessible tissue: Callus, score: 57.985 | N | N | N | N |
| vg0101141375 | GT -> AT | LOC_Os01g02990-LOC_Os01g03010 | intergenic_region ; MODIFIER | silent_mutation | Average:40.61; most accessible tissue: Callus, score: 57.985 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0101141375 | 1.21E-06 | 1.21E-06 | mr1499_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |