\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101093889:

Variant ID: vg0101093889 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 1093889
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.08, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTATGCATGACTTGTCTTTTTAATTTTTTTTATAATTTTTTCAAATAAGACGGACGGTCAAACGTTAGACACAGAAAGGATTTGTCTTTTTTTTTTAC[A/G]
GAGGGAGCAAGTACTTCCGTTTTTTCAGTGTGTAAAGGATGGAGAAGGCTGACTTTTTTTTTTTTGTAGTGAACGAAACCGTTTCATCTCGCCGGCACAC

Reverse complement sequence

GTGTGCCGGCGAGATGAAACGGTTTCGTTCACTACAAAAAAAAAAAAGTCAGCCTTCTCCATCCTTTACACACTGAAAAAACGGAAGTACTTGCTCCCTC[T/C]
GTAAAAAAAAAAGACAAATCCTTTCTGTGTCTAACGTTTGACCGTCCGTCTTATTTGAAAAAATTATAAAAAAAATTAAAAAGACAAGTCATGCATAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.70% 30.60% 0.91% 36.80% NA
All Indica  2759 3.40% 39.70% 1.23% 55.74% NA
All Japonica  1512 86.60% 3.20% 0.13% 10.05% NA
Aus  269 12.60% 79.90% 0.37% 7.06% NA
Indica I  595 1.20% 5.00% 1.18% 92.61% NA
Indica II  465 4.10% 72.00% 0.22% 23.66% NA
Indica III  913 1.20% 44.80% 1.53% 52.46% NA
Indica Intermediate  786 7.10% 40.70% 1.53% 50.64% NA
Temperate Japonica  767 91.90% 3.10% 0.13% 4.82% NA
Tropical Japonica  504 75.40% 4.40% 0.00% 20.24% NA
Japonica Intermediate  241 93.40% 0.80% 0.41% 5.39% NA
VI/Aromatic  96 32.30% 59.40% 1.04% 7.29% NA
Intermediate  90 34.40% 34.40% 5.56% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0101093889 A -> G LOC_Os01g02940.1 upstream_gene_variant ; 361.0bp to feature; MODIFIER silent_mutation Average:71.692; most accessible tissue: Minghui63 root, score: 89.894 N N N N
vg0101093889 A -> G LOC_Os01g02940.2 upstream_gene_variant ; 361.0bp to feature; MODIFIER silent_mutation Average:71.692; most accessible tissue: Minghui63 root, score: 89.894 N N N N
vg0101093889 A -> G LOC_Os01g02940.3 upstream_gene_variant ; 361.0bp to feature; MODIFIER silent_mutation Average:71.692; most accessible tissue: Minghui63 root, score: 89.894 N N N N
vg0101093889 A -> G LOC_Os01g02940.4 upstream_gene_variant ; 361.0bp to feature; MODIFIER silent_mutation Average:71.692; most accessible tissue: Minghui63 root, score: 89.894 N N N N
vg0101093889 A -> G LOC_Os01g02940.6 upstream_gene_variant ; 361.0bp to feature; MODIFIER silent_mutation Average:71.692; most accessible tissue: Minghui63 root, score: 89.894 N N N N
vg0101093889 A -> G LOC_Os01g02950.1 downstream_gene_variant ; 3691.0bp to feature; MODIFIER silent_mutation Average:71.692; most accessible tissue: Minghui63 root, score: 89.894 N N N N
vg0101093889 A -> G LOC_Os01g02940-LOC_Os01g02950 intergenic_region ; MODIFIER silent_mutation Average:71.692; most accessible tissue: Minghui63 root, score: 89.894 N N N N
vg0101093889 A -> DEL N N silent_mutation Average:71.692; most accessible tissue: Minghui63 root, score: 89.894 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0101093889 A G 0.01 0.01 0.0 0.0 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0101093889 NA 9.42E-06 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101093889 NA 9.28E-10 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101093889 NA 1.09E-08 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101093889 NA 2.72E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101093889 NA 9.57E-08 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101093889 NA 8.57E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101093889 NA 3.30E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101093889 NA 1.90E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101093889 NA 4.37E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101093889 NA 6.41E-09 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101093889 NA 2.69E-09 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101093889 NA 7.94E-08 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101093889 NA 8.34E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101093889 NA 1.01E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101093889 NA 3.94E-09 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101093889 NA 5.76E-11 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101093889 3.33E-06 3.56E-06 mr1219_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101093889 NA 6.40E-08 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101093889 NA 8.74E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251