\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101042259:

Variant ID: vg0101042259 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 1042259
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, C: 0.37, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GATAAATTTCAGTAGAGCTTTTGCCTGACCTGCTTTGTAGCCAGAAGCCCCAAATTTTTCAGGCAGATACAGAACTACAAAGTAGAGCTAGATAGAAATC[C/A]
TTTTTCTTTAGGGGCAATTGCTTATTTGACCCCGTTTTGAACTCTAACTACCAATTTGACCCTACTTTTTGAAGTTTACTTATTTGACCCTCCTTTTTAA

Reverse complement sequence

TTAAAAAGGAGGGTCAAATAAGTAAACTTCAAAAAGTAGGGTCAAATTGGTAGTTAGAGTTCAAAACGGGGTCAAATAAGCAATTGCCCCTAAAGAAAAA[G/T]
GATTTCTATCTAGCTCTACTTTGTAGTTCTGTATCTGCCTGAAAAATTTGGGGCTTCTGGCTACAAAGCAGGTCAGGCAAAAGCTCTACTGAAATTTATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.90% 20.20% 4.66% 4.17% NA
All Indica  2759 59.00% 27.00% 7.07% 6.89% NA
All Japonica  1512 98.60% 1.20% 0.07% 0.13% NA
Aus  269 32.00% 59.90% 7.43% 0.74% NA
Indica I  595 97.00% 2.50% 0.34% 0.17% NA
Indica II  465 29.70% 41.90% 16.56% 11.83% NA
Indica III  913 52.00% 34.50% 4.71% 8.76% NA
Indica Intermediate  786 55.90% 28.00% 9.29% 6.87% NA
Temperate Japonica  767 99.50% 0.30% 0.00% 0.26% NA
Tropical Japonica  504 97.00% 2.80% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 15.60% 1.04% 1.04% NA
Intermediate  90 74.40% 20.00% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0101042259 C -> A LOC_Os01g02890.1 upstream_gene_variant ; 4345.0bp to feature; MODIFIER silent_mutation Average:45.033; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0101042259 C -> A LOC_Os01g02884-LOC_Os01g02890 intergenic_region ; MODIFIER silent_mutation Average:45.033; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0101042259 C -> DEL N N silent_mutation Average:45.033; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0101042259 NA 4.09E-06 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 1.36E-08 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 2.94E-09 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 6.99E-10 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 8.65E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 3.12E-09 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 3.66E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 3.54E-09 mr1324 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 5.38E-07 mr1333 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 4.77E-08 mr1335 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 4.49E-06 NA mr1338 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 1.56E-08 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 8.22E-06 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 1.63E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 4.41E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 4.36E-09 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 5.99E-06 5.98E-06 mr1623 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 6.08E-07 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 3.44E-09 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 1.22E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 1.63E-07 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 8.05E-06 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 4.52E-06 mr1879 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 7.87E-07 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 1.01E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 5.29E-09 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 8.18E-10 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 8.60E-17 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 1.87E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 3.21E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 4.68E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 3.62E-08 mr1616_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 7.35E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 8.07E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 3.72E-12 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 5.21E-09 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 6.52E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 5.20E-09 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101042259 NA 7.35E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251