\
| Variant ID: vg0101040689 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 1040689 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 254. )
TCATAATCAGCCCTCCGGAAATATAGGCTTCGGCTGAACCTTGTTAATGAAATATCATGCCTTGATGTCATCATCGCATTTGGATTTCACACGGTGTACT[T/C]
TCGTGTTTGGCTACTAATGTCGATTAATTAATTTGTTGCCGGCTTTTATAGAAAAACAGTAATGCTCATGTATTTTTGTGAGACCAAAATTTGTTTGAGT
ACTCAAACAAATTTTGGTCTCACAAAAATACATGAGCATTACTGTTTTTCTATAAAAGCCGGCAACAAATTAATTAATCGACATTAGTAGCCAAACACGA[A/G]
AGTACACCGTGTGAAATCCAAATGCGATGATGACATCAAGGCATGATATTTCATTAACAAGGTTCAGCCGAAGCCTATATTTCCGGAGGGCTGATTATGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 75.30% | 24.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 63.80% | 36.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 28.10% | 71.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0101040689 | T -> C | LOC_Os01g02884-LOC_Os01g02890 | intergenic_region ; MODIFIER | silent_mutation | Average:63.21; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0101040689 | NA | 5.62E-10 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0101040689 | 4.91E-06 | NA | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101040689 | NA | 9.15E-09 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101040689 | NA | 1.88E-08 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101040689 | NA | 1.45E-06 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101040689 | 1.64E-08 | NA | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101040689 | NA | 1.01E-10 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101040689 | NA | 1.61E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101040689 | NA | 2.32E-07 | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101040689 | NA | 3.47E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101040689 | 2.48E-09 | 8.21E-15 | mr1829_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101040689 | NA | 1.25E-09 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101040689 | 4.06E-06 | 6.33E-17 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101040689 | NA | 2.34E-08 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |