\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101018863:

Variant ID: vg0101018863 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 1018863
Reference Allele: ATTAlternative Allele: TTT,A
Primary Allele: ATTSecondary Allele: TTT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGCTGAACACAAGCAGAAGGCCACTCCAGAAGCCATTGCGAAGCACACCCTTACAATGCTGAGGAGGAGAGTGCCGCCTGCTGTCCCTGGAATCATGGT[ATT/TTT,A]
TTCTTAGCTCTTGATTCTCATAGTAATTTTATCTTCTATACCATCTCCATTCGAAACCAACTGGACAGAGTTCTGTAACTTTGTTCGTTTTGTTTTCTCC

Reverse complement sequence

GGAGAAAACAAAACGAACAAAGTTACAGAACTCTGTCCAGTTGGTTTCGAATGGAGATGGTATAGAAGATAAAATTACTATGAGAATCAAGAGCTAAGAA[AAT/AAA,T]
ACCATGATTCCAGGGACAGCAGGCGGCACTCTCCTCCTCAGCATTGTAAGGGTGTGCTTCGCAATGGCTTCTGGAGTGGCCTTCTGCTTGTGTTCAGCTC

Allele Frequencies:

Populations Population SizeFrequency of ATT(primary allele) Frequency of TTT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.00% 10.00% 0.00% 0.00% A: 0.02%
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 74.90% 25.10% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.00% 0.00% A: 0.37%
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 63.50% 36.50% 0.00% 0.00% NA
Tropical Japonica  504 92.30% 7.70% 0.00% 0.00% NA
Japonica Intermediate  241 75.10% 24.90% 0.00% 0.00% NA
VI/Aromatic  96 33.30% 66.70% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0101018863 ATT -> TTT LOC_Os01g02880.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:87.236; most accessible tissue: Minghui63 panicle, score: 92.231 N N N N
vg0101018863 ATT -> A LOC_Os01g02880.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:87.236; most accessible tissue: Minghui63 panicle, score: 92.231 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0101018863 ATT A 0.02 -0.03 0.01 0.0 -0.01 -0.04
vg0101018863 ATT TTT 0.0 0.0 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0101018863 1.83E-06 NA mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101018863 NA 4.08E-09 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101018863 6.08E-06 9.29E-08 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101018863 NA 5.57E-07 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101018863 NA 6.62E-06 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101018863 1.44E-10 NA mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101018863 9.92E-07 3.18E-11 mr1354_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101018863 NA 3.70E-07 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101018863 7.93E-09 1.32E-11 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101018863 NA 3.93E-10 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101018863 NA 8.52E-09 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251