\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0100999668:

Variant ID: vg0100999668 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 999668
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.25, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


TAATCCAAACCTTCTTTTATTCAAATGAAAATAAAAGAAAAAGAAACAAAGTTACCTATTGCATACTTCAAGTCTTATTTTTAGCTAATCTGATCTTATA[C/T]
TATCTTATCCCCATTAAAATCCCTAAGTGGTGGCTTTCTAATTTCTATTCGTAATAAATGTGTTGATAGTCCGTTCGTTCTTCTGTTTCTATGGAAAGAT

Reverse complement sequence

ATCTTTCCATAGAAACAGAAGAACGAACGGACTATCAACACATTTATTACGAATAGAAATTAGAAAGCCACCACTTAGGGATTTTAATGGGGATAAGATA[G/A]
TATAAGATCAGATTAGCTAAAAATAAGACTTGAAGTATGCAATAGGTAACTTTGTTTCTTTTTCTTTTATTTTCATTTGAATAAAAGAAGGTTTGGATTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.80% 12.50% 1.46% 54.15% NA
All Indica  2759 7.10% 18.20% 1.59% 73.07% NA
All Japonica  1512 69.40% 0.20% 0.86% 29.56% NA
Aus  269 49.80% 28.60% 3.35% 18.22% NA
Indica I  595 2.90% 8.40% 3.19% 85.55% NA
Indica II  465 5.60% 1.50% 1.94% 90.97% NA
Indica III  913 3.30% 34.60% 0.44% 61.66% NA
Indica Intermediate  786 15.60% 16.50% 1.53% 66.28% NA
Temperate Japonica  767 93.70% 0.00% 0.26% 6.00% NA
Tropical Japonica  504 23.60% 0.60% 1.98% 73.81% NA
Japonica Intermediate  241 87.60% 0.00% 0.41% 12.03% NA
VI/Aromatic  96 88.50% 4.20% 0.00% 7.29% NA
Intermediate  90 45.60% 6.70% 3.33% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0100999668 C -> T LOC_Os01g02830.1 upstream_gene_variant ; 2406.0bp to feature; MODIFIER silent_mutation Average:8.737; most accessible tissue: Callus, score: 45.642 N N N N
vg0100999668 C -> T LOC_Os01g02850.1 downstream_gene_variant ; 1624.0bp to feature; MODIFIER silent_mutation Average:8.737; most accessible tissue: Callus, score: 45.642 N N N N
vg0100999668 C -> T LOC_Os01g02860.1 downstream_gene_variant ; 2791.0bp to feature; MODIFIER silent_mutation Average:8.737; most accessible tissue: Callus, score: 45.642 N N N N
vg0100999668 C -> T LOC_Os01g02840.1 intron_variant ; MODIFIER silent_mutation Average:8.737; most accessible tissue: Callus, score: 45.642 N N N N
vg0100999668 C -> DEL N N silent_mutation Average:8.737; most accessible tissue: Callus, score: 45.642 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0100999668 NA 9.81E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100999668 NA 1.61E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100999668 NA 5.40E-06 mr1230_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100999668 NA 1.65E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100999668 NA 7.82E-07 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100999668 NA 2.15E-06 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100999668 NA 1.44E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100999668 NA 9.70E-06 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100999668 NA 7.17E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100999668 NA 1.33E-09 mr1568_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100999668 NA 9.60E-07 mr1568_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100999668 NA 9.34E-06 mr1790_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100999668 NA 8.64E-08 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100999668 NA 3.56E-06 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251