| Variant ID: vg0100936862 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 936862 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, A: 0.33, others allele: 0.00, population size: 58. )
TAGTGGAAGGGTACGGAACAATATAGGCTATAGCATTATAGGTGTGTATCACTCAAAAAGAATATTAGAGCTATGATGATTAAATGAAGGTAATTCAAGC[G/A]
TACCAAAATAGAGCTTGATGATAACGATGGCAGATACTATGATAACCATAAGTGTCATAAACTTTGTAGAGCTTGATGATAACGATGGCAGATACTATGA
TCATAGTATCTGCCATCGTTATCATCAAGCTCTACAAAGTTTATGACACTTATGGTTATCATAGTATCTGCCATCGTTATCATCAAGCTCTATTTTGGTA[C/T]
GCTTGAATTACCTTCATTTAATCATCATAGCTCTAATATTCTTTTTGAGTGATACACACCTATAATGCTATAGCCTATATTGTTCCGTACCCTTCCACTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.80% | 30.00% | 6.39% | 26.83% | NA |
| All Indica | 2759 | 44.80% | 19.20% | 9.93% | 25.99% | NA |
| All Japonica | 1512 | 28.80% | 41.50% | 0.60% | 29.03% | NA |
| Aus | 269 | 5.60% | 76.60% | 2.97% | 14.87% | NA |
| Indica I | 595 | 66.20% | 4.20% | 5.88% | 23.70% | NA |
| Indica II | 465 | 72.50% | 6.70% | 4.52% | 16.34% | NA |
| Indica III | 913 | 15.00% | 32.70% | 16.21% | 36.04% | NA |
| Indica Intermediate | 786 | 46.90% | 22.40% | 8.91% | 21.76% | NA |
| Temperate Japonica | 767 | 2.30% | 63.10% | 0.78% | 33.77% | NA |
| Tropical Japonica | 504 | 76.80% | 6.50% | 0.60% | 16.07% | NA |
| Japonica Intermediate | 241 | 12.90% | 46.10% | 0.00% | 41.08% | NA |
| VI/Aromatic | 96 | 5.20% | 29.20% | 3.12% | 62.50% | NA |
| Intermediate | 90 | 48.90% | 28.90% | 8.89% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0100936862 | G -> A | LOC_Os01g02730.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:68.145; most accessible tissue: Minghui63 flag leaf, score: 80.786 | N | N | N | N |
| vg0100936862 | G -> A | LOC_Os01g02720.1 | upstream_gene_variant ; 2404.0bp to feature; MODIFIER | silent_mutation | Average:68.145; most accessible tissue: Minghui63 flag leaf, score: 80.786 | N | N | N | N |
| vg0100936862 | G -> A | LOC_Os01g02720.2 | upstream_gene_variant ; 1948.0bp to feature; MODIFIER | silent_mutation | Average:68.145; most accessible tissue: Minghui63 flag leaf, score: 80.786 | N | N | N | N |
| vg0100936862 | G -> A | LOC_Os01g02740.1 | downstream_gene_variant ; 3143.0bp to feature; MODIFIER | silent_mutation | Average:68.145; most accessible tissue: Minghui63 flag leaf, score: 80.786 | N | N | N | N |
| vg0100936862 | G -> DEL | N | N | silent_mutation | Average:68.145; most accessible tissue: Minghui63 flag leaf, score: 80.786 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0100936862 | NA | 1.07E-06 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100936862 | NA | 1.33E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100936862 | NA | 2.28E-08 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100936862 | NA | 3.41E-08 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100936862 | NA | 3.69E-06 | mr1185 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100936862 | NA | 2.20E-07 | mr1269 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100936862 | NA | 8.38E-09 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100936862 | NA | 8.35E-07 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100936862 | NA | 9.25E-07 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100936862 | NA | 5.38E-08 | mr1678 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/