Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0100936862:

Variant ID: vg0100936862 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 936862
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, A: 0.33, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTGGAAGGGTACGGAACAATATAGGCTATAGCATTATAGGTGTGTATCACTCAAAAAGAATATTAGAGCTATGATGATTAAATGAAGGTAATTCAAGC[G/A]
TACCAAAATAGAGCTTGATGATAACGATGGCAGATACTATGATAACCATAAGTGTCATAAACTTTGTAGAGCTTGATGATAACGATGGCAGATACTATGA

Reverse complement sequence

TCATAGTATCTGCCATCGTTATCATCAAGCTCTACAAAGTTTATGACACTTATGGTTATCATAGTATCTGCCATCGTTATCATCAAGCTCTATTTTGGTA[C/T]
GCTTGAATTACCTTCATTTAATCATCATAGCTCTAATATTCTTTTTGAGTGATACACACCTATAATGCTATAGCCTATATTGTTCCGTACCCTTCCACTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.80%	30.00%	6.39%	26.83%	NA
All Indica	2759	44.80%	19.20%	9.93%	25.99%	NA
All Japonica	1512	28.80%	41.50%	0.60%	29.03%	NA
Aus	269	5.60%	76.60%	2.97%	14.87%	NA
Indica I	595	66.20%	4.20%	5.88%	23.70%	NA
Indica II	465	72.50%	6.70%	4.52%	16.34%	NA
Indica III	913	15.00%	32.70%	16.21%	36.04%	NA
Indica Intermediate	786	46.90%	22.40%	8.91%	21.76%	NA
Temperate Japonica	767	2.30%	63.10%	0.78%	33.77%	NA
Tropical Japonica	504	76.80%	6.50%	0.60%	16.07%	NA
Japonica Intermediate	241	12.90%	46.10%	0.00%	41.08%	NA
VI/Aromatic	96	5.20%	29.20%	3.12%	62.50%	NA
Intermediate	90	48.90%	28.90%	8.89%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0100936862	G -> A	LOC_Os01g02730.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:68.145; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0100936862	G -> A	LOC_Os01g02720.1	upstream_gene_variant ; 2404.0bp to feature; MODIFIER	silent_mutation	Average:68.145; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0100936862	G -> A	LOC_Os01g02720.2	upstream_gene_variant ; 1948.0bp to feature; MODIFIER	silent_mutation	Average:68.145; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0100936862	G -> A	LOC_Os01g02740.1	downstream_gene_variant ; 3143.0bp to feature; MODIFIER	silent_mutation	Average:68.145; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0100936862	G -> DEL	N	N	silent_mutation	Average:68.145; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0100936862	NA	1.07E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	1.33E-06	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	2.28E-08	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	3.41E-08	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	3.69E-06	mr1185	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	2.20E-07	mr1269	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	8.38E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	8.35E-07	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	9.25E-07	mr1677	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	5.38E-08	mr1678	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	5.25E-06	mr1975	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	2.67E-06	mr1060_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	6.49E-07	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	8.36E-06	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	6.64E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	2.51E-08	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	6.03E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	6.55E-09	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	9.90E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	1.02E-06	mr1296_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	7.74E-07	mr1296_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	3.28E-06	mr1331_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	9.13E-10	mr1352_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	2.38E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	1.20E-06	mr1358_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	3.70E-06	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	2.89E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	2.36E-06	mr1388_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	2.66E-06	mr1442_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	3.22E-06	mr1469_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	9.47E-06	mr1469_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	1.38E-09	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	3.88E-06	mr1554_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	1.01E-11	mr1582_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	1.84E-06	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	9.38E-07	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	9.43E-06	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	1.76E-07	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	7.12E-08	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	5.90E-06	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	1.29E-07	mr1882_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	3.98E-06	mr1954_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100936862	NA	7.09E-06	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251