Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0100916093:

Variant ID: vg0100916093 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 916093
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCATCTTTGACAATCTACAGCCTTACGACTACCATAGATGTAAATTATACAGCTGGGCTCCTGCAAAAATAGTACGCTGTTCAAAAGAGTTCACACCAA[A/G]
TGGTACTTCTCCAGTCGATGGCTACGCTTTCATGAACAACGCCGATTATATCACCGGCCCAATCTCCTGCCCCAGTGAGGCAAGTCACTTCTCATATTTG

Reverse complement sequence

CAAATATGAGAAGTGACTTGCCTCACTGGGGCAGGAGATTGGGCCGGTGATATAATCGGCGTTGTTCATGAAAGCGTAGCCATCGACTGGAGAAGTACCA[T/C]
TTGGTGTGAACTCTTTTGAACAGCGTACTATTTTTGCAGGAGCCCAGCTGTATAATTTACATCTATGGTAGTCGTAAGGCTGTAGATTGTCAAAGATGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.70% 28.50% 1.42% 1.35% NA
All Indica  2759 93.60% 4.80% 0.69% 0.91% NA
All Japonica  1512 31.00% 68.80% 0.26% 0.00% NA
Aus  269 48.30% 27.50% 13.38% 10.78% NA
Indica I  595 97.60% 1.80% 0.50% 0.00% NA
Indica II  465 94.40% 5.20% 0.22% 0.22% NA
Indica III  913 96.90% 1.10% 0.77% 1.20% NA
Indica Intermediate  786 86.10% 11.20% 1.02% 1.65% NA
Temperate Japonica  767 6.40% 93.40% 0.26% 0.00% NA
Tropical Japonica  504 77.20% 22.40% 0.40% 0.00% NA
Japonica Intermediate  241 12.40% 87.60% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 75.00% 5.21% 7.29% NA
Intermediate  90 60.00% 33.30% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0100916093 A -> G LOC_Os01g02690.1 missense_variant ; p.Asn152Ser; MODERATE nonsynonymous_codon Average:77.104; most accessible tissue: Minghui63 flag leaf, score: 93.917 benign 0.007 TOLERATED 1.00
vg0100916093 A -> DEL LOC_Os01g02690.1 N frameshift_variant Average:77.104; most accessible tissue: Minghui63 flag leaf, score: 93.917 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0100916093 A G 0.0 0.0 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0100916093 NA 1.70E-06 mr1557 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100916093 4.07E-06 NA mr1723_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251