\
| Variant ID: vg0100780655 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 780655 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, T: 0.08, others allele: 0.00, population size: 63. )
GTAAAAGTTTGATGATAAAATCCAGTCATAAAAAAATAAATAATACTTAGTATATATTTTTTACTGAATTGAATGGCCAAACGTTACGTCAAAAACTAAT[G/T]
GCGTCCGCTGTAAAAAATAAACATACATGCGTGTTGCAAACTTCTGACTGTAGTACTGTACGACAACAAAGCTCAACTTTTGACTGTACTTGTATGACAA
TTGTCATACAAGTACAGTCAAAAGTTGAGCTTTGTTGTCGTACAGTACTACAGTCAGAAGTTTGCAACACGCATGTATGTTTATTTTTTACAGCGGACGC[C/A]
ATTAGTTTTTGACGTAACGTTTGGCCATTCAATTCAGTAAAAAATATATACTAAGTATTATTTATTTTTTTATGACTGGATTTTATCATCAAACTTTTAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.10% | 22.90% | 0.57% | 33.45% | NA |
| All Indica | 2759 | 47.10% | 21.80% | 0.43% | 30.66% | NA |
| All Japonica | 1512 | 44.80% | 28.80% | 0.33% | 26.12% | NA |
| Aus | 269 | 4.50% | 3.70% | 2.97% | 88.85% | NA |
| Indica I | 595 | 2.90% | 67.60% | 0.34% | 29.24% | NA |
| Indica II | 465 | 87.70% | 4.10% | 0.22% | 7.96% | NA |
| Indica III | 913 | 53.60% | 3.20% | 0.22% | 43.04% | NA |
| Indica Intermediate | 786 | 49.10% | 19.20% | 0.89% | 30.79% | NA |
| Temperate Japonica | 767 | 69.10% | 2.10% | 0.52% | 28.29% | NA |
| Tropical Japonica | 504 | 6.00% | 77.40% | 0.00% | 16.67% | NA |
| Japonica Intermediate | 241 | 48.50% | 12.00% | 0.41% | 39.00% | NA |
| VI/Aromatic | 96 | 7.30% | 7.30% | 0.00% | 85.42% | NA |
| Intermediate | 90 | 46.70% | 30.00% | 2.22% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0100780655 | G -> T | LOC_Os01g02410.1 | upstream_gene_variant ; 1418.0bp to feature; MODIFIER | silent_mutation | Average:70.253; most accessible tissue: Minghui63 flower, score: 81.554 | N | N | N | N |
| vg0100780655 | G -> T | LOC_Os01g02420.1 | upstream_gene_variant ; 787.0bp to feature; MODIFIER | silent_mutation | Average:70.253; most accessible tissue: Minghui63 flower, score: 81.554 | N | N | N | N |
| vg0100780655 | G -> T | LOC_Os01g02410-LOC_Os01g02420 | intergenic_region ; MODIFIER | silent_mutation | Average:70.253; most accessible tissue: Minghui63 flower, score: 81.554 | N | N | N | N |
| vg0100780655 | G -> DEL | N | N | silent_mutation | Average:70.253; most accessible tissue: Minghui63 flower, score: 81.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0100780655 | NA | 5.41E-06 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 7.72E-06 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 7.75E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 1.85E-07 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 1.35E-10 | mr1059 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 8.15E-14 | mr1143 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 4.96E-12 | mr1167 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 9.16E-07 | mr1399 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 5.78E-07 | mr1479 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 5.53E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 3.06E-12 | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 2.79E-08 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 7.72E-12 | mr1675 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 2.47E-09 | mr1726 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 8.86E-09 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 1.29E-08 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 1.62E-06 | mr1912 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 7.97E-06 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 6.18E-08 | mr1942 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 1.58E-09 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 1.67E-12 | mr1969 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 9.26E-06 | mr1975 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 1.47E-13 | mr1995 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 1.89E-07 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 2.51E-10 | mr1167_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 1.53E-09 | mr1327_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 3.05E-06 | mr1332_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 3.44E-06 | mr1360_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 5.95E-07 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 2.08E-08 | mr1383_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 5.60E-06 | mr1543_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 3.00E-10 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 3.29E-06 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 3.64E-06 | mr1648_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 4.56E-10 | mr1715_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 2.08E-07 | mr1726_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 2.14E-10 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 9.28E-11 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 1.05E-15 | mr1794_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 1.65E-13 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 9.97E-06 | mr1892_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 4.39E-07 | mr1904_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 1.71E-11 | mr1942_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 1.55E-06 | mr1950_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100780655 | NA | 2.98E-07 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |