\
| Variant ID: vg0100694746 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 694746 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 96. )
CATCCATCAGTTTGTTCATGTGAAGGTTGTAATGACCCCGTTCCACAATTTGAGTTATTGCCGATGCTGGCTAGTTGAAATCTTCATGTCCCTCGGGCTC[A/G]
CTGGGTTCACTGATGCCGTCTACTCCGTCGTGTAAACTCTGCTCCCAGTCCTTGCCATAAGTAAGGACGCATGCTCTTAACATATCCTCCATAATCTGGT
ACCAGATTATGGAGGATATGTTAAGAGCATGCGTCCTTACTTATGGCAAGGACTGGGAGCAGAGTTTACACGACGGAGTAGACGGCATCAGTGAACCCAG[T/C]
GAGCCCGAGGGACATGAAGATTTCAACTAGCCAGCATCGGCAATAACTCAAATTGTGGAACGGGGTCATTACAACCTTCACATGAACAAACTGATGGATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.20% | 14.30% | 7.66% | 49.92% | NA |
| All Indica | 2759 | 26.40% | 1.70% | 10.51% | 61.47% | NA |
| All Japonica | 1512 | 21.00% | 40.70% | 0.66% | 37.70% | NA |
| Aus | 269 | 66.20% | 0.40% | 15.61% | 17.84% | NA |
| Indica I | 595 | 1.50% | 0.80% | 25.55% | 72.10% | NA |
| Indica II | 465 | 70.80% | 2.60% | 1.51% | 25.16% | NA |
| Indica III | 913 | 14.70% | 0.30% | 5.04% | 79.96% | NA |
| Indica Intermediate | 786 | 32.40% | 3.30% | 10.81% | 53.44% | NA |
| Temperate Japonica | 767 | 22.40% | 65.40% | 0.13% | 11.99% | NA |
| Tropical Japonica | 504 | 15.10% | 3.60% | 0.60% | 80.75% | NA |
| Japonica Intermediate | 241 | 28.60% | 39.40% | 2.49% | 29.46% | NA |
| VI/Aromatic | 96 | 67.70% | 0.00% | 12.50% | 19.79% | NA |
| Intermediate | 90 | 48.90% | 13.30% | 8.89% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0100694746 | A -> G | LOC_Os01g02260.1 | synonymous_variant ; p.Ser385Ser; LOW | synonymous_codon | Average:25.041; most accessible tissue: Minghui63 young leaf, score: 33.985 | N | N | N | N |
| vg0100694746 | A -> DEL | LOC_Os01g02260.1 | N | frameshift_variant | Average:25.041; most accessible tissue: Minghui63 young leaf, score: 33.985 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0100694746 | NA | 4.37E-08 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 4.70E-08 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 4.19E-09 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 4.56E-06 | mr1060_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 9.79E-07 | mr1060_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 6.22E-06 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 4.53E-06 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 1.61E-08 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 2.27E-07 | mr1296_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 1.07E-08 | mr1331_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 7.69E-07 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 1.81E-06 | mr1358_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 9.39E-06 | mr1554_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | 5.55E-06 | NA | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 3.37E-06 | mr1568_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 4.02E-06 | mr1582_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 2.01E-13 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 6.46E-06 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 2.69E-06 | mr1735_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 9.51E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 1.17E-07 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 1.08E-07 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100694746 | NA | 3.26E-07 | mr1882_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |