\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0100694746:

Variant ID: vg0100694746 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 694746
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


CATCCATCAGTTTGTTCATGTGAAGGTTGTAATGACCCCGTTCCACAATTTGAGTTATTGCCGATGCTGGCTAGTTGAAATCTTCATGTCCCTCGGGCTC[A/G]
CTGGGTTCACTGATGCCGTCTACTCCGTCGTGTAAACTCTGCTCCCAGTCCTTGCCATAAGTAAGGACGCATGCTCTTAACATATCCTCCATAATCTGGT

Reverse complement sequence

ACCAGATTATGGAGGATATGTTAAGAGCATGCGTCCTTACTTATGGCAAGGACTGGGAGCAGAGTTTACACGACGGAGTAGACGGCATCAGTGAACCCAG[T/C]
GAGCCCGAGGGACATGAAGATTTCAACTAGCCAGCATCGGCAATAACTCAAATTGTGGAACGGGGTCATTACAACCTTCACATGAACAAACTGATGGATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.20% 14.30% 7.66% 49.92% NA
All Indica  2759 26.40% 1.70% 10.51% 61.47% NA
All Japonica  1512 21.00% 40.70% 0.66% 37.70% NA
Aus  269 66.20% 0.40% 15.61% 17.84% NA
Indica I  595 1.50% 0.80% 25.55% 72.10% NA
Indica II  465 70.80% 2.60% 1.51% 25.16% NA
Indica III  913 14.70% 0.30% 5.04% 79.96% NA
Indica Intermediate  786 32.40% 3.30% 10.81% 53.44% NA
Temperate Japonica  767 22.40% 65.40% 0.13% 11.99% NA
Tropical Japonica  504 15.10% 3.60% 0.60% 80.75% NA
Japonica Intermediate  241 28.60% 39.40% 2.49% 29.46% NA
VI/Aromatic  96 67.70% 0.00% 12.50% 19.79% NA
Intermediate  90 48.90% 13.30% 8.89% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0100694746 A -> G LOC_Os01g02260.1 synonymous_variant ; p.Ser385Ser; LOW synonymous_codon Average:25.041; most accessible tissue: Minghui63 young leaf, score: 33.985 N N N N
vg0100694746 A -> DEL LOC_Os01g02260.1 N frameshift_variant Average:25.041; most accessible tissue: Minghui63 young leaf, score: 33.985 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0100694746 NA 4.37E-08 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 4.70E-08 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 4.19E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 4.56E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 9.79E-07 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 6.22E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 4.53E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 1.61E-08 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 2.27E-07 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 1.07E-08 mr1331_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 7.69E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 1.81E-06 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 9.39E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 5.55E-06 NA mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 3.37E-06 mr1568_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 4.02E-06 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 2.01E-13 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 6.46E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 2.69E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 9.51E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 1.17E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 1.08E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100694746 NA 3.26E-07 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251