\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0100674416:

Variant ID: vg0100674416 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 674416
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, C: 0.15, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


AGTAGCTGAATAGAATATTGTATTGCTTATGGACTAGTTCTACACTACATTGTGGATGCCCTAACATCAACGAAAATACGAATTATAAAAAAATTTCATA[T/C]
AAGACGGACAGTCAAAGTTGGACACAGAAACCAAGGGTTTGCCTTTTTTTTTTTTTTTGACGGAGGGAGTACTCTACTTTGCTCCTTTGCTAGTTCCGAC

Reverse complement sequence

GTCGGAACTAGCAAAGGAGCAAAGTAGAGTACTCCCTCCGTCAAAAAAAAAAAAAAAGGCAAACCCTTGGTTTCTGTGTCCAACTTTGACTGTCCGTCTT[A/G]
TATGAAATTTTTTTATAATTCGTATTTTCGTTGATGTTAGGGCATCCACAATGTAGTGTAGAACTAGTCCATAAGCAATACAATATTCTATTCAGCTACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.20% 37.50% 4.68% 17.54% NA
All Indica  2759 18.70% 46.40% 7.43% 27.51% NA
All Japonica  1512 69.10% 29.60% 0.66% 0.60% NA
Aus  269 78.40% 4.50% 0.37% 16.73% NA
Indica I  595 3.00% 83.70% 9.24% 4.03% NA
Indica II  465 19.40% 10.30% 2.80% 67.53% NA
Indica III  913 25.70% 45.30% 8.32% 20.59% NA
Indica Intermediate  786 21.90% 40.70% 7.76% 29.64% NA
Temperate Japonica  767 93.20% 4.70% 0.91% 1.17% NA
Tropical Japonica  504 23.40% 76.00% 0.60% 0.00% NA
Japonica Intermediate  241 88.00% 12.00% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 8.30% 0.00% 3.12% NA
Intermediate  90 51.10% 28.90% 5.56% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0100674416 T -> DEL N N silent_mutation Average:44.399; most accessible tissue: Zhenshan97 panicle, score: 93.752 N N N N
vg0100674416 T -> C LOC_Os01g02230.1 upstream_gene_variant ; 3440.0bp to feature; MODIFIER silent_mutation Average:44.399; most accessible tissue: Zhenshan97 panicle, score: 93.752 N N N N
vg0100674416 T -> C LOC_Os01g02240.1 downstream_gene_variant ; 4362.0bp to feature; MODIFIER silent_mutation Average:44.399; most accessible tissue: Zhenshan97 panicle, score: 93.752 N N N N
vg0100674416 T -> C LOC_Os01g02230-LOC_Os01g02240 intergenic_region ; MODIFIER silent_mutation Average:44.399; most accessible tissue: Zhenshan97 panicle, score: 93.752 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0100674416 T C 0.09 0.01 0.0 0.04 0.06 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0100674416 NA 4.00E-10 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 2.13E-08 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 1.31E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 1.29E-07 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 7.30E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 2.07E-09 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 5.30E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 1.34E-07 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 2.51E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 1.85E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 7.97E-10 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 2.22E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 7.18E-08 mr1268_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 7.97E-10 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 1.78E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 5.87E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 4.05E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 1.67E-08 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 5.43E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100674416 NA 1.66E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251