Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0100617428:

Variant ID: vg0100617428 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 617428
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.53, G: 0.49, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

ACTTGAGGTGTATAAACTTTAGGTGTATAAATTTACTAAAATAGAAAAGTAATATGGTGCCAAAAAAGGAAACCAGTTGGAGGGGTGGAGGGAGGGAGGC[A/G]
GGAGGGGATCGATCGCTACCCCCGTCTCCAGGTGATCGATCGCCCATTAGGATCCCCCGTGTCCGCGCGCAACCGGGGGATCTACACTACCGAATACTGT

Reverse complement sequence

ACAGTATTCGGTAGTGTAGATCCCCCGGTTGCGCGCGGACACGGGGGATCCTAATGGGCGATCGATCACCTGGAGACGGGGGTAGCGATCGATCCCCTCC[T/C]
GCCTCCCTCCCTCCACCCCTCCAACTGGTTTCCTTTTTTGGCACCATATTACTTTTCTATTTTAGTAAATTTATACACCTAAAGTTTATACACCTCAAGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.20%	32.90%	7.60%	15.32%	NA
All Indica	2759	17.10%	45.70%	11.89%	25.34%	NA
All Japonica	1512	92.30%	5.30%	1.92%	0.46%	NA
Aus	269	38.70%	61.00%	0.00%	0.37%	NA
Indica I	595	3.50%	74.50%	18.49%	3.53%	NA
Indica II	465	19.80%	10.50%	2.80%	66.88%	NA
Indica III	913	23.20%	48.50%	13.47%	14.79%	NA
Indica Intermediate	786	18.60%	41.50%	10.43%	29.52%	NA
Temperate Japonica	767	87.50%	7.80%	3.78%	0.91%	NA
Tropical Japonica	504	98.20%	1.80%	0.00%	0.00%	NA
Japonica Intermediate	241	95.40%	4.60%	0.00%	0.00%	NA
VI/Aromatic	96	68.80%	27.10%	1.04%	3.12%	NA
Intermediate	90	57.80%	25.60%	1.11%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0100617428	A -> G	LOC_Os01g02120.1	downstream_gene_variant ; 1778.0bp to feature; MODIFIER	silent_mutation	Average:57.31; most accessible tissue: Callus, score: 97.558	N	N	N	N
vg0100617428	A -> G	LOC_Os01g02130.1	downstream_gene_variant ; 3144.0bp to feature; MODIFIER	silent_mutation	Average:57.31; most accessible tissue: Callus, score: 97.558	N	N	N	N
vg0100617428	A -> G	LOC_Os01g02120-LOC_Os01g02130	intergenic_region ; MODIFIER	silent_mutation	Average:57.31; most accessible tissue: Callus, score: 97.558	N	N	N	N
vg0100617428	A -> DEL	N	N	silent_mutation	Average:57.31; most accessible tissue: Callus, score: 97.558	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0100617428	A	G	-0.21	-0.13	-0.12	-0.12	-0.15	-0.15

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0100617428	NA	7.87E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100617428	NA	1.76E-07	mr1269	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100617428	NA	1.36E-06	mr1269	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100617428	NA	2.40E-06	mr1479	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100617428	NA	4.11E-06	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100617428	NA	2.16E-15	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100617428	NA	3.36E-08	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100617428	NA	1.79E-08	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100617428	NA	7.87E-18	mr1726	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100617428	NA	1.57E-09	mr1726	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100617428	NA	1.95E-08	mr1975	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100617428	NA	2.33E-07	mr1975	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100617428	NA	1.04E-17	mr1995	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100617428	NA	4.87E-07	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251