Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0100561383:

Variant ID: vg0100561383 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 561383
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCATCATTCAATCTCTTCTATTAATCCTGAGATTCTTTCAGGTCATAGGAACATCGCGTATGGCTCTGTTCATATGCATGGATTGGGAACCATCCCTC[C/T]
AGCACGGAAAACGAAACAGTTCATTAGTGCTTGATTGATTAATATTTTATTATTTTTAAAAAATAGATCAATATGTATTTTAAGCTACTTTCATATATAA

Reverse complement sequence

TTATATATGAAAGTAGCTTAAAATACATATTGATCTATTTTTTAAAAATAATAAAATATTAATCAATCAAGCACTAATGAACTGTTTCGTTTTCCGTGCT[G/A]
GAGGGATGGTTCCCAATCCATGCATATGAACAGAGCCATACGCGATGTTCCTATGACCTGAAAGAATCTCAGGATTAATAGAAGAGATTGAATGATGAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.20% 29.80% 0.04% 0.00% NA
All Indica  2759 51.60% 48.30% 0.07% 0.00% NA
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 92.20% 7.80% 0.00% 0.00% NA
Indica I  595 23.20% 76.80% 0.00% 0.00% NA
Indica II  465 30.50% 69.20% 0.22% 0.00% NA
Indica III  913 80.60% 19.30% 0.11% 0.00% NA
Indica Intermediate  786 51.90% 48.10% 0.00% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0100561383 C -> T LOC_Os01g02040.1 upstream_gene_variant ; 3368.0bp to feature; MODIFIER silent_mutation Average:81.518; most accessible tissue: Minghui63 root, score: 95.34 N N N N
vg0100561383 C -> T LOC_Os01g02040.2 upstream_gene_variant ; 3368.0bp to feature; MODIFIER silent_mutation Average:81.518; most accessible tissue: Minghui63 root, score: 95.34 N N N N
vg0100561383 C -> T LOC_Os01g02050.1 downstream_gene_variant ; 673.0bp to feature; MODIFIER silent_mutation Average:81.518; most accessible tissue: Minghui63 root, score: 95.34 N N N N
vg0100561383 C -> T LOC_Os01g02040-LOC_Os01g02050 intergenic_region ; MODIFIER silent_mutation Average:81.518; most accessible tissue: Minghui63 root, score: 95.34 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0100561383 C T -0.02 0.0 -0.01 0.0 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0100561383 NA 3.03E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100561383 NA 2.87E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100561383 NA 3.50E-08 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100561383 NA 3.38E-16 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100561383 NA 2.94E-08 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100561383 NA 3.74E-07 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100561383 NA 3.17E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100561383 NA 9.23E-24 mr1870_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100561383 NA 3.81E-09 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100561383 NA 7.49E-07 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251