\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0100543265:

Variant ID: vg0100543265 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 543265
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


AGTCTCAAGAATGGTGGAGAGTTCAGTTCAGTGACTAAAATACTTTCACTGAAATACCTTCAGGGTTCAGCCTTCAGGGAATGGCAATTGTATGCAACTG[A/G]
AGACAGTGATCCGTTCCTAGATGCATTAACATGTATAAAATACGCATCGCAGTATCGCAAATGACATGAGGTTACTTTTGTTTGGCACCATTTCATTGTC

Reverse complement sequence

GACAATGAAATGGTGCCAAACAAAAGTAACCTCATGTCATTTGCGATACTGCGATGCGTATTTTATACATGTTAATGCATCTAGGAACGGATCACTGTCT[T/C]
CAGTTGCATACAATTGCCATTCCCTGAAGGCTGAACCCTGAAGGTATTTCAGTGAAAGTATTTTAGTCACTGAACTGAACTCTCCACCATTCTTGAGACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.30% 7.90% 0.85% 0.00% NA
All Indica  2759 99.30% 0.50% 0.14% 0.00% NA
All Japonica  1512 74.70% 23.20% 2.05% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 98.50% 0.90% 0.65% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 98.20% 1.00% 0.78% 0.00% NA
Tropical Japonica  504 30.20% 65.70% 4.17% 0.00% NA
Japonica Intermediate  241 93.40% 5.00% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 6.70% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0100543265 A -> G LOC_Os01g02000.1 3_prime_UTR_variant ; 200.0bp to feature; MODIFIER silent_mutation Average:55.145; most accessible tissue: Callus, score: 82.373 N N N N
vg0100543265 A -> G LOC_Os01g02010.1 3_prime_UTR_variant ; 276.0bp to feature; MODIFIER silent_mutation Average:55.145; most accessible tissue: Callus, score: 82.373 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0100543265 NA 7.93E-07 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100543265 NA 2.22E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100543265 5.31E-09 NA mr1194_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100543265 9.54E-07 3.74E-10 mr1194_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100543265 NA 7.61E-07 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100543265 NA 3.82E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100543265 NA 2.69E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100543265 NA 1.52E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100543265 NA 4.49E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100543265 NA 5.06E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100543265 NA 2.31E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100543265 NA 9.22E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100543265 NA 4.72E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100543265 NA 2.06E-12 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100543265 6.61E-06 NA mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100543265 2.78E-06 1.93E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251