\
| Variant ID: vg0100503766 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 503766 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 241. )
GAGAGTAGGAATACAAGAATTAACCAAGTGTTTTACATCATATTATAGGAAAATAAGACATGACTGAGGAAATAATAAATCAGACAAACTGTCTGTAAAG[T/C]
TTTATTTACAATAAATGCTAATGTGATAGTCGTCAATTCAACGGTACTTGCCAATTGGCGCACCTTGGCCGATATTAAACTCTAGTGAGATCAACCCTGC
GCAGGGTTGATCTCACTAGAGTTTAATATCGGCCAAGGTGCGCCAATTGGCAAGTACCGTTGAATTGACGACTATCACATTAGCATTTATTGTAAATAAA[A/G]
CTTTACAGACAGTTTGTCTGATTTATTATTTCCTCAGTCATGTCTTATTTTCCTATAATATGATGTAAAACACTTGGTTAATTCTTGTATTCCTACTCTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 29.40% | 70.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0100503766 | T -> C | LOC_Os01g01925.1 | upstream_gene_variant ; 3504.0bp to feature; MODIFIER | silent_mutation | Average:41.734; most accessible tissue: Callus, score: 82.449 | N | N | N | N |
| vg0100503766 | T -> C | LOC_Os01g01920.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.734; most accessible tissue: Callus, score: 82.449 | N | N | N | N |
| vg0100503766 | T -> C | LOC_Os01g01920.2 | intron_variant ; MODIFIER | silent_mutation | Average:41.734; most accessible tissue: Callus, score: 82.449 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0100503766 | NA | 3.87E-10 | mr1415 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100503766 | NA | 4.03E-43 | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100503766 | NA | 1.65E-47 | mr1550 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100503766 | NA | 3.87E-10 | mr1567 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100503766 | NA | 1.55E-41 | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100503766 | NA | 1.62E-09 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100503766 | NA | 8.42E-32 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100503766 | 6.71E-06 | 5.88E-52 | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100503766 | NA | 3.88E-10 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100503766 | NA | 7.46E-33 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100503766 | NA | 1.99E-07 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100503766 | NA | 1.73E-17 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |