\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0100490718:

Variant ID: vg0100490718 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 490718
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGTTATGTTTTCGTTTGGTACTGACATTTGCATTTGAGGAGTCAACATTATAGGTGGCATCGCACACAGAAATTTGATAAAGTTGTTCCTGTCCAACG[G/A]
CGAGACCAACCTCTTTATTATCATGCATAATTATACATCTATTGTTTCCAAAAGTACAATAGTAACCACCGTTATCTAAACGTGAAACTGAAACTAAGTT

Reverse complement sequence

AACTTAGTTTCAGTTTCACGTTTAGATAACGGTGGTTACTATTGTACTTTTGGAAACAATAGATGTATAATTATGCATGATAATAAAGAGGTTGGTCTCG[C/T]
CGTTGGACAGGAACAACTTTATCAAATTTCTGTGTGCGATGCCACCTATAATGTTGACTCCTCAAATGCAAATGTCAGTACCAAACGAAAACATAACGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 33.50% 0.21% 0.00% NA
All Indica  2759 49.90% 49.90% 0.22% 0.00% NA
All Japonica  1512 92.50% 7.50% 0.00% 0.00% NA
Aus  269 73.20% 25.30% 1.49% 0.00% NA
Indica I  595 12.10% 87.90% 0.00% 0.00% NA
Indica II  465 86.20% 13.50% 0.22% 0.00% NA
Indica III  913 50.30% 49.60% 0.11% 0.00% NA
Indica Intermediate  786 56.50% 43.00% 0.51% 0.00% NA
Temperate Japonica  767 87.90% 12.10% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 5.00% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0100490718 G -> A LOC_Os01g01890.1 downstream_gene_variant ; 4226.0bp to feature; MODIFIER silent_mutation Average:27.171; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0100490718 G -> A LOC_Os01g01900.1 intron_variant ; MODIFIER silent_mutation Average:27.171; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0100490718 NA 5.88E-08 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 7.29E-16 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 1.43E-11 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 2.46E-15 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 1.97E-09 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 8.47E-07 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 7.67E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 5.94E-06 mr1479 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 7.82E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 9.75E-17 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 1.21E-10 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 4.62E-16 mr1675 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 1.70E-10 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 1.97E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 5.72E-15 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 3.93E-09 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 3.82E-07 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 9.32E-09 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 3.76E-10 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 2.10E-06 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 3.25E-17 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100490718 NA 5.69E-12 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251