\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0100449701:

Variant ID: vg0100449701 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 449701
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTATACCGTGGTGTATAATTTGTATTCGTGATTGGCTGGATGTATGTAATTAAGCGGGTGATAGGTTTGGCATATTCTTTCGGCTGTATCTTCTGCTGT[G/A]
AAGGACCATAGGCGATTTAAACACAAGGGCCCCAGGTGATGGGAGTTTTCTTCTTTTTTTTCCTTCTTCCTTTTAGAAACATGAGTTTTGTCGTTGCAAG

Reverse complement sequence

CTTGCAACGACAAAACTCATGTTTCTAAAAGGAAGAAGGAAAAAAAAGAAGAAAACTCCCATCACCTGGGGCCCTTGTGTTTAAATCGCCTATGGTCCTT[C/T]
ACAGCAGAAGATACAGCCGAAAGAATATGCCAAACCTATCACCCGCTTAATTACATACATCCAGCCAATCACGAATACAAATTATACACCACGGTATAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.80% 34.10% 1.38% 1.69% NA
All Indica  2759 64.40% 35.30% 0.25% 0.04% NA
All Japonica  1512 68.00% 23.70% 3.57% 4.76% NA
Aus  269 16.40% 83.30% 0.00% 0.37% NA
Indica I  595 69.20% 30.80% 0.00% 0.00% NA
Indica II  465 86.50% 13.30% 0.22% 0.00% NA
Indica III  913 49.80% 49.90% 0.11% 0.11% NA
Indica Intermediate  786 64.50% 34.90% 0.64% 0.00% NA
Temperate Japonica  767 84.50% 13.20% 1.43% 0.91% NA
Tropical Japonica  504 48.60% 46.60% 2.38% 2.38% NA
Japonica Intermediate  241 56.00% 9.10% 12.86% 21.99% NA
VI/Aromatic  96 69.80% 28.10% 2.08% 0.00% NA
Intermediate  90 58.90% 32.20% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0100449701 G -> A LOC_Os01g01830.1 downstream_gene_variant ; 564.0bp to feature; MODIFIER silent_mutation Average:77.706; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0100449701 G -> A LOC_Os01g01830-LOC_Os01g01840 intergenic_region ; MODIFIER silent_mutation Average:77.706; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0100449701 G -> DEL N N silent_mutation Average:77.706; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0100449701 G A -0.05 -0.03 -0.03 -0.04 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0100449701 NA 4.83E-06 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100449701 2.15E-06 2.15E-06 mr1327 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100449701 NA 7.85E-06 mr1342 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100449701 NA 8.01E-06 mr1352 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100449701 NA 6.94E-06 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100449701 NA 1.80E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100449701 NA 1.53E-06 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100449701 NA 3.95E-06 mr1559 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100449701 NA 5.16E-06 mr1653 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100449701 NA 9.80E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100449701 NA 4.71E-06 mr1678 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100449701 NA 2.01E-06 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100449701 1.75E-07 3.63E-09 mr1696 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100449701 4.91E-06 4.91E-06 mr1939 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251