\
| Variant ID: vg0100409422 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 409422 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATGAGCATGTCCTGAATAATATCCTCAAAACCAGAAGATGATGATGTGTAAAGCATGCAGCAGAATATTGGTGAAGCTTTCTACTCCATCGGTTCGAAAA[T/C]
ATAAACCATTTTGAAGAAATGTGACACATTATATACTATGAATCTGGATACGGAGCCTGTCCAGATTCGTAGTAGAGGATATGTCAAAAACGGAGGGAGT
ACTCCCTCCGTTTTTGACATATCCTCTACTACGAATCTGGACAGGCTCCGTATCCAGATTCATAGTATATAATGTGTCACATTTCTTCAAAATGGTTTAT[A/G]
TTTTCGAACCGATGGAGTAGAAAGCTTCACCAATATTCTGCTGCATGCTTTACACATCATCATCTTCTGGTTTTGAGGATATTATTCAGGACATGCTCAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.90% | 5.10% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 37.20% | 62.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.20% | 1.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0100409422 | T -> C | LOC_Os01g01770.1 | upstream_gene_variant ; 278.0bp to feature; MODIFIER | silent_mutation | Average:52.649; most accessible tissue: Minghui63 flower, score: 77.232 | N | N | N | N |
| vg0100409422 | T -> C | LOC_Os01g01780.1 | upstream_gene_variant ; 3157.0bp to feature; MODIFIER | silent_mutation | Average:52.649; most accessible tissue: Minghui63 flower, score: 77.232 | N | N | N | N |
| vg0100409422 | T -> C | LOC_Os01g01760-LOC_Os01g01770 | intergenic_region ; MODIFIER | silent_mutation | Average:52.649; most accessible tissue: Minghui63 flower, score: 77.232 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0100409422 | 3.27E-06 | NA | mr1013 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100409422 | NA | 1.16E-06 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100409422 | NA | 1.16E-06 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100409422 | NA | 3.41E-08 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100409422 | 6.16E-06 | NA | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100409422 | NA | 6.58E-09 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100409422 | NA | 1.33E-17 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |