\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0100409422:

Variant ID: vg0100409422 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 409422
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGAGCATGTCCTGAATAATATCCTCAAAACCAGAAGATGATGATGTGTAAAGCATGCAGCAGAATATTGGTGAAGCTTTCTACTCCATCGGTTCGAAAA[T/C]
ATAAACCATTTTGAAGAAATGTGACACATTATATACTATGAATCTGGATACGGAGCCTGTCCAGATTCGTAGTAGAGGATATGTCAAAAACGGAGGGAGT

Reverse complement sequence

ACTCCCTCCGTTTTTGACATATCCTCTACTACGAATCTGGACAGGCTCCGTATCCAGATTCATAGTATATAATGTGTCACATTTCTTCAAAATGGTTTAT[A/G]
TTTTCGAACCGATGGAGTAGAAAGCTTCACCAATATTCTGCTGCATGCTTTACACATCATCATCTTCTGGTTTTGAGGATATTATTCAGGACATGCTCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 5.10% 0.02% 0.00% NA
All Indica  2759 98.40% 1.60% 0.04% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 37.20% 62.80% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.20% 1.60% 0.11% 0.00% NA
Indica Intermediate  786 96.40% 3.60% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0100409422 T -> C LOC_Os01g01770.1 upstream_gene_variant ; 278.0bp to feature; MODIFIER silent_mutation Average:52.649; most accessible tissue: Minghui63 flower, score: 77.232 N N N N
vg0100409422 T -> C LOC_Os01g01780.1 upstream_gene_variant ; 3157.0bp to feature; MODIFIER silent_mutation Average:52.649; most accessible tissue: Minghui63 flower, score: 77.232 N N N N
vg0100409422 T -> C LOC_Os01g01760-LOC_Os01g01770 intergenic_region ; MODIFIER silent_mutation Average:52.649; most accessible tissue: Minghui63 flower, score: 77.232 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0100409422 3.27E-06 NA mr1013 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100409422 NA 1.16E-06 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100409422 NA 1.16E-06 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100409422 NA 3.41E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100409422 6.16E-06 NA mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100409422 NA 6.58E-09 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100409422 NA 1.33E-17 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251