RiceVarMap2

Detailed information for vg0100239153:

Variant ID: vg0100239153 (JBrowse)

Variation Type: SNP

Chromosome: chr01

Position: 239153

Reference Allele: G

Alternative Allele: A

Primary Allele: G

Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTAGTCCAAGATTATGGATGGGTTTTATTAATAGTCTACGTTTAATATTTATAATTAATTTTCAAACATCCGATGTGATAGGGACTTAAAAGTTTTTA[G/A]
TCCCATCTAAACAGGACCTCAGTAGCTAGCTTTTAGTGACTACTCCTATTTAGCCCCACCTTCATTGACTTTATTAATCATATCAGCATCATATATATAT

Reverse complement sequence

ATATATATATGATGCTGATATGATTAATAAAGTCAATGAAGGTGGGGCTAAATAGGAGTAGTCACTAAAAGCTAGCTACTGAGGTCCTGTTTAGATGGGA[C/T]
TAAAAACTTTTAAGTCCCTATCACATCGGATGTTTGAAAATTAATTATAAATATTAAACGTAGACTATTAATAAAACCCATCCATAATCTTGGACTAATT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.90%	0.10%	3.26%	41.73%	NA
All Indica	2759	37.50%	0.10%	3.48%	58.86%	NA
All Japonica	1512	90.90%	0.00%	1.19%	7.87%	NA
Aus	269	16.40%	0.00%	13.38%	70.26%	NA
Indica I	595	8.60%	0.50%	5.88%	85.04%	NA
Indica II	465	37.20%	0.00%	1.51%	61.29%	NA
Indica III	913	60.00%	0.00%	1.97%	38.01%	NA
Indica Intermediate	786	33.50%	0.10%	4.58%	61.83%	NA
Temperate Japonica	767	87.20%	0.00%	0.39%	12.39%	NA
Tropical Japonica	504	92.90%	0.00%	2.58%	4.56%	NA
Japonica Intermediate	241	98.80%	0.00%	0.83%	0.41%	NA
VI/Aromatic	96	80.20%	0.00%	2.08%	17.71%	NA
Intermediate	90	71.10%	1.10%	2.22%	25.56%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0100239153	G -> A	LOC_Os01g01470.1	upstream_gene_variant ; 2488.0bp to feature; MODIFIER	silent_mutation	Average:36.056; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0100239153	G -> A	LOC_Os01g01460-LOC_Os01g01470	intergenic_region ; MODIFIER	silent_mutation	Average:36.056; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0100239153	G -> DEL	N	N	silent_mutation	Average:36.056; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0100239153	2.69E-06	NA	mr1093	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100239153	2.68E-07	2.68E-07	mr1266	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0100239153:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact