\
| Variant ID: vg0100068121 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 68121 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.16, others allele: 0.00, population size: 232. )
TGTGTTAGCGTGCCAGTTGATTTGATCCTGCAATCAACAAGAAATAGAAACAAACAGATCGCGGTTAAATCTATAAATGATAGCCGATCGGCTAAGTGCC[G/A]
ATGACATATCATTTATCTTTGAGCCGATGTCATATGTGAATTGATCGGCGACTATAAATAGATAATAAAGAACTAAACCTACTCGATCGGCTGTAGATAT
ATATCTACAGCCGATCGAGTAGGTTTAGTTCTTTATTATCTATTTATAGTCGCCGATCAATTCACATATGACATCGGCTCAAAGATAAATGATATGTCAT[C/T]
GGCACTTAGCCGATCGGCTATCATTTATAGATTTAACCGCGATCTGTTTGTTTCTATTTCTTGTTGATTGCAGGATCAAATCAACTGGCACGCTAACACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.80% | 22.60% | 0.15% | 0.47% | NA |
| All Indica | 2759 | 70.80% | 28.20% | 0.22% | 0.80% | NA |
| All Japonica | 1512 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 17.50% | 82.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 29.70% | 68.70% | 0.50% | 1.01% | NA |
| Indica II | 465 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 87.00% | 11.80% | 0.11% | 1.10% | NA |
| Indica Intermediate | 786 | 67.90% | 31.00% | 0.25% | 0.76% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0100068121 | G -> A | LOC_Os01g01130.1 | upstream_gene_variant ; 1819.0bp to feature; MODIFIER | silent_mutation | Average:36.385; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0100068121 | G -> A | LOC_Os01g01140.1 | upstream_gene_variant ; 1554.0bp to feature; MODIFIER | silent_mutation | Average:36.385; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0100068121 | G -> A | LOC_Os01g01150.1 | upstream_gene_variant ; 4654.0bp to feature; MODIFIER | silent_mutation | Average:36.385; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0100068121 | G -> A | LOC_Os01g01150.2 | upstream_gene_variant ; 4654.0bp to feature; MODIFIER | silent_mutation | Average:36.385; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0100068121 | G -> A | LOC_Os01g01150.3 | upstream_gene_variant ; 4654.0bp to feature; MODIFIER | silent_mutation | Average:36.385; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0100068121 | G -> A | LOC_Os01g01120.1 | downstream_gene_variant ; 4545.0bp to feature; MODIFIER | silent_mutation | Average:36.385; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0100068121 | G -> A | LOC_Os01g01130-LOC_Os01g01140 | intergenic_region ; MODIFIER | silent_mutation | Average:36.385; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0100068121 | G -> DEL | N | N | silent_mutation | Average:36.385; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0100068121 | NA | 1.23E-09 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100068121 | 1.95E-06 | NA | mr1047_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100068121 | NA | 7.16E-06 | mr1047_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100068121 | NA | 8.60E-06 | mr1189_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100068121 | NA | 3.56E-07 | mr1265_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100068121 | NA | 8.91E-06 | mr1265_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100068121 | NA | 1.30E-07 | mr1528_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0100068121 | NA | 4.46E-06 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |