\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0100068121:

Variant ID: vg0100068121 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 68121
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.16, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGTTAGCGTGCCAGTTGATTTGATCCTGCAATCAACAAGAAATAGAAACAAACAGATCGCGGTTAAATCTATAAATGATAGCCGATCGGCTAAGTGCC[G/A]
ATGACATATCATTTATCTTTGAGCCGATGTCATATGTGAATTGATCGGCGACTATAAATAGATAATAAAGAACTAAACCTACTCGATCGGCTGTAGATAT

Reverse complement sequence

ATATCTACAGCCGATCGAGTAGGTTTAGTTCTTTATTATCTATTTATAGTCGCCGATCAATTCACATATGACATCGGCTCAAAGATAAATGATATGTCAT[C/T]
GGCACTTAGCCGATCGGCTATCATTTATAGATTTAACCGCGATCTGTTTGTTTCTATTTCTTGTTGATTGCAGGATCAAATCAACTGGCACGCTAACACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.80% 22.60% 0.15% 0.47% NA
All Indica  2759 70.80% 28.20% 0.22% 0.80% NA
All Japonica  1512 97.60% 2.40% 0.00% 0.00% NA
Aus  269 17.50% 82.50% 0.00% 0.00% NA
Indica I  595 29.70% 68.70% 0.50% 1.01% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 87.00% 11.80% 0.11% 1.10% NA
Indica Intermediate  786 67.90% 31.00% 0.25% 0.76% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 93.80% 6.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 81.20% 18.80% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0100068121 G -> A LOC_Os01g01130.1 upstream_gene_variant ; 1819.0bp to feature; MODIFIER silent_mutation Average:36.385; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0100068121 G -> A LOC_Os01g01140.1 upstream_gene_variant ; 1554.0bp to feature; MODIFIER silent_mutation Average:36.385; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0100068121 G -> A LOC_Os01g01150.1 upstream_gene_variant ; 4654.0bp to feature; MODIFIER silent_mutation Average:36.385; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0100068121 G -> A LOC_Os01g01150.2 upstream_gene_variant ; 4654.0bp to feature; MODIFIER silent_mutation Average:36.385; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0100068121 G -> A LOC_Os01g01150.3 upstream_gene_variant ; 4654.0bp to feature; MODIFIER silent_mutation Average:36.385; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0100068121 G -> A LOC_Os01g01120.1 downstream_gene_variant ; 4545.0bp to feature; MODIFIER silent_mutation Average:36.385; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0100068121 G -> A LOC_Os01g01130-LOC_Os01g01140 intergenic_region ; MODIFIER silent_mutation Average:36.385; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0100068121 G -> DEL N N silent_mutation Average:36.385; most accessible tissue: Minghui63 root, score: 52.955 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0100068121 NA 1.23E-09 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100068121 1.95E-06 NA mr1047_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100068121 NA 7.16E-06 mr1047_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100068121 NA 8.60E-06 mr1189_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100068121 NA 3.56E-07 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100068121 NA 8.91E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100068121 NA 1.30E-07 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100068121 NA 4.46E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251