\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0100044434:

Variant ID: vg0100044434 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 44434
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


CTGTACAGGCCTAGGCCCATTAGTACTCCCGATACCCTAAAAATACCGAAGTCCAAACATCGCTTCGTCTTCCCCGCCGAGACTCTCGCCATTCCCCACT[C/T]
CGTGCTACAGTACAGAACCGCGCCGACGAAGTTAGGTTCATCAATCCGCTCCAATCCATCCTCAAAAACTTCACGAAATTTCTCCCCGCATCCACCGCTC

Reverse complement sequence

GAGCGGTGGATGCGGGGAGAAATTTCGTGAAGTTTTTGAGGATGGATTGGAGCGGATTGATGAACCTAACTTCGTCGGCGCGGTTCTGTACTGTAGCACG[G/A]
AGTGGGGAATGGCGAGAGTCTCGGCGGGGAAGACGAAGCGATGTTTGGACTTCGGTATTTTTAGGGTATCGGGAGTACTAATGGGCCTAGGCCTGTACAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.10% 17.60% 0.23% 0.00% NA
All Indica  2759 72.10% 27.50% 0.33% 0.00% NA
All Japonica  1512 97.80% 2.20% 0.00% 0.00% NA
Aus  269 87.00% 12.60% 0.37% 0.00% NA
Indica I  595 28.90% 69.90% 1.18% 0.00% NA
Indica II  465 96.30% 3.40% 0.22% 0.00% NA
Indica III  913 88.60% 11.30% 0.11% 0.00% NA
Indica Intermediate  786 71.40% 28.60% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 94.00% 6.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0100044434 C -> T LOC_Os01g01090.1 upstream_gene_variant ; 161.0bp to feature; MODIFIER silent_mutation Average:34.743; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg0100044434 C -> T LOC_Os01g01080.1 downstream_gene_variant ; 3254.0bp to feature; MODIFIER silent_mutation Average:34.743; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg0100044434 C -> T LOC_Os01g01100.1 downstream_gene_variant ; 3422.0bp to feature; MODIFIER silent_mutation Average:34.743; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg0100044434 C -> T LOC_Os01g01080.2 downstream_gene_variant ; 3254.0bp to feature; MODIFIER silent_mutation Average:34.743; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg0100044434 C -> T LOC_Os01g01080.3 downstream_gene_variant ; 3254.0bp to feature; MODIFIER silent_mutation Average:34.743; most accessible tissue: Minghui63 root, score: 54.099 N N N N
vg0100044434 C -> T LOC_Os01g01080-LOC_Os01g01090 intergenic_region ; MODIFIER silent_mutation Average:34.743; most accessible tissue: Minghui63 root, score: 54.099 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0100044434 9.92E-06 1.90E-06 mr1047_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251