Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0100043649:

Variant ID: vg0100043649 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 43649
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.52, T: 0.49, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GTAACCGCCATGTGGATTTGGGGTAACCATAATCTCCACAGTTGCCCCCGAGACCTTCACAGTTGACCAAAATAGTCTTCTCGAAACAAAAAACAATAAT[T/C]
CGAGTGCTTCAATTCAACTTGCTCCGGCTTGCCGAGTGCTAAAAGACTGTGAAGGGCGAAAATAAAACATGGTGCATCGAGTAGATGCACCTAATTAGGT

Reverse complement sequence

ACCTAATTAGGTGCATCTACTCGATGCACCATGTTTTATTTTCGCCCTTCACAGTCTTTTAGCACTCGGCAAGCCGGAGCAAGTTGAATTGAAGCACTCG[A/G]
ATTATTGTTTTTTGTTTCGAGAAGACTATTTTGGTCAACTGTGAAGGTCTCGGGGGCAACTGTGGAGATTATGGTTACCCCAAATCCACATGGCGGTTAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.80%	23.10%	1.10%	0.00%	NA
All Indica	2759	69.70%	28.70%	1.59%	0.00%	NA
All Japonica	1512	97.60%	2.40%	0.00%	0.00%	NA
Aus	269	10.40%	87.00%	2.60%	0.00%	NA
Indica I	595	29.60%	65.50%	4.87%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	86.30%	13.40%	0.33%	0.00%	NA
Indica Intermediate	786	64.60%	33.80%	1.53%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	93.80%	6.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	81.20%	18.80%	0.00%	0.00%	NA
Intermediate	90	84.40%	14.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0100043649	T -> C	LOC_Os01g01090.1	upstream_gene_variant ; 946.0bp to feature; MODIFIER	silent_mutation	Average:28.829; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0100043649	T -> C	LOC_Os01g01080.1	downstream_gene_variant ; 2469.0bp to feature; MODIFIER	silent_mutation	Average:28.829; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0100043649	T -> C	LOC_Os01g01100.1	downstream_gene_variant ; 4207.0bp to feature; MODIFIER	silent_mutation	Average:28.829; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0100043649	T -> C	LOC_Os01g01080.2	downstream_gene_variant ; 2469.0bp to feature; MODIFIER	silent_mutation	Average:28.829; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0100043649	T -> C	LOC_Os01g01080.3	downstream_gene_variant ; 2469.0bp to feature; MODIFIER	silent_mutation	Average:28.829; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0100043649	T -> C	LOC_Os01g01080-LOC_Os01g01090	intergenic_region ; MODIFIER	silent_mutation	Average:28.829; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0100043649	NA	1.44E-06	mr1600	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100043649	NA	5.46E-09	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100043649	3.45E-06	5.46E-07	mr1884	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100043649	NA	8.53E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251